FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640966_at:

>probe:Drosophila_2:1640966_at:530:689; Interrogation_Position=1004; Antisense; TTTGCAACAGCAACCTCGAAGTGGT
>probe:Drosophila_2:1640966_at:178:371; Interrogation_Position=1021; Antisense; GAAGTGGTAGACACGCCATTCAGCC
>probe:Drosophila_2:1640966_at:57:309; Interrogation_Position=1036; Antisense; CCATTCAGCCTGATTTGCGCATAAA
>probe:Drosophila_2:1640966_at:239:171; Interrogation_Position=1093; Antisense; AAAGGGCTCAGGCTGTAGCTCCATA
>probe:Drosophila_2:1640966_at:457:5; Interrogation_Position=1151; Antisense; ATTGCAGTTGCAGAGCCGATCGAAA
>probe:Drosophila_2:1640966_at:290:173; Interrogation_Position=1202; Antisense; AAAGCAACTGCTTCAGGCTGAACTG
>probe:Drosophila_2:1640966_at:346:199; Interrogation_Position=759; Antisense; AACGAGGAGCGGGAATCTACAACAA
>probe:Drosophila_2:1640966_at:511:353; Interrogation_Position=787; Antisense; GCACTGTTAAACCATCTTTGGCTCC
>probe:Drosophila_2:1640966_at:597:563; Interrogation_Position=821; Antisense; GGCAACTAAGCCTCCAATCGGCAAG
>probe:Drosophila_2:1640966_at:502:175; Interrogation_Position=858; Antisense; AAACCTTTGACAACGCGTGCTACCA
>probe:Drosophila_2:1640966_at:65:389; Interrogation_Position=895; Antisense; GAAAACTTCCATGTTGCACCAAGCC
>probe:Drosophila_2:1640966_at:98:211; Interrogation_Position=921; Antisense; AAGAATCACGGTGTCGCTGGGACTC
>probe:Drosophila_2:1640966_at:32:503; Interrogation_Position=933; Antisense; GTCGCTGGGACTCCAAATGTCATCA
>probe:Drosophila_2:1640966_at:613:229; Interrogation_Position=948; Antisense; AATGTCATCAGCTTTTCTCTGAATG

Paste this into a BLAST search page for me
TTTGCAACAGCAACCTCGAAGTGGTGAAGTGGTAGACACGCCATTCAGCCCCATTCAGCCTGATTTGCGCATAAAAAAGGGCTCAGGCTGTAGCTCCATAATTGCAGTTGCAGAGCCGATCGAAAAAAGCAACTGCTTCAGGCTGAACTGAACGAGGAGCGGGAATCTACAACAAGCACTGTTAAACCATCTTTGGCTCCGGCAACTAAGCCTCCAATCGGCAAGAAACCTTTGACAACGCGTGCTACCAGAAAACTTCCATGTTGCACCAAGCCAAGAATCACGGTGTCGCTGGGACTCGTCGCTGGGACTCCAAATGTCATCAAATGTCATCAGCTTTTCTCTGAATG

Full Affymetrix probeset data:

Annotations for 1640966_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720