FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640967_at:

>probe:Drosophila_2:1640967_at:632:193; Interrogation_Position=1022; Antisense; AACTGCCGTGTTATGTGGGTCGTCT
>probe:Drosophila_2:1640967_at:509:455; Interrogation_Position=1063; Antisense; GATAATCCCCGCCTGCAAATTTATT
>probe:Drosophila_2:1640967_at:513:233; Interrogation_Position=1116; Antisense; AATGCCGTGCATTAAGCGCTACATC
>probe:Drosophila_2:1640967_at:615:323; Interrogation_Position=1131; Antisense; GCGCTACATCATTGGCAACTGGCTG
>probe:Drosophila_2:1640967_at:645:151; Interrogation_Position=1160; Antisense; ACATCTGCAAGTTGTTCTGCCTGGA
>probe:Drosophila_2:1640967_at:2:235; Interrogation_Position=1196; Antisense; AATGCGCCCGTGATGCTTTGGTCGA
>probe:Drosophila_2:1640967_at:468:247; Interrogation_Position=668; Antisense; AATTCCCGTTGCATTTGTGGCATCA
>probe:Drosophila_2:1640967_at:462:595; Interrogation_Position=683; Antisense; TGTGGCATCACCTGTGTGACATGCT
>probe:Drosophila_2:1640967_at:691:611; Interrogation_Position=699; Antisense; TGACATGCTGGAAGTGGCACCCGAT
>probe:Drosophila_2:1640967_at:476:335; Interrogation_Position=750; Antisense; GCTGCTGCACTCGAGGATCCTAAAC
>probe:Drosophila_2:1640967_at:189:387; Interrogation_Position=798; Antisense; GAACACCAAGGCATTTGCGCTGCTA
>probe:Drosophila_2:1640967_at:18:175; Interrogation_Position=870; Antisense; AAAGCTGCTTTACGACGTCTTTGCC
>probe:Drosophila_2:1640967_at:499:565; Interrogation_Position=948; Antisense; GGAATATACGGCTTTGGCCCTGCTC
>probe:Drosophila_2:1640967_at:63:65; Interrogation_Position=974; Antisense; ATGGGCTCCATAGCAAGCGGGCATT

Paste this into a BLAST search page for me
AACTGCCGTGTTATGTGGGTCGTCTGATAATCCCCGCCTGCAAATTTATTAATGCCGTGCATTAAGCGCTACATCGCGCTACATCATTGGCAACTGGCTGACATCTGCAAGTTGTTCTGCCTGGAAATGCGCCCGTGATGCTTTGGTCGAAATTCCCGTTGCATTTGTGGCATCATGTGGCATCACCTGTGTGACATGCTTGACATGCTGGAAGTGGCACCCGATGCTGCTGCACTCGAGGATCCTAAACGAACACCAAGGCATTTGCGCTGCTAAAAGCTGCTTTACGACGTCTTTGCCGGAATATACGGCTTTGGCCCTGCTCATGGGCTCCATAGCAAGCGGGCATT

Full Affymetrix probeset data:

Annotations for 1640967_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720