FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640970_at:

>probe:Drosophila_2:1640970_at:686:503; Interrogation_Position=2079; Antisense; GTCCACGTTTTCGACCTAAATGTGA
>probe:Drosophila_2:1640970_at:5:49; Interrogation_Position=2124; Antisense; ATCCAGGCCGTGGTGCCCAAGCGAA
>probe:Drosophila_2:1640970_at:97:387; Interrogation_Position=2150; Antisense; GAACAAGCTCACCAGGTTATCCTTC
>probe:Drosophila_2:1640970_at:53:423; Interrogation_Position=2178; Antisense; GAGAAGCTCGCCTTCATTGTGGTGG
>probe:Drosophila_2:1640970_at:453:109; Interrogation_Position=2209; Antisense; AGAAGGGCGTCACCACTTCGCTGAA
>probe:Drosophila_2:1640970_at:263:685; Interrogation_Position=2236; Antisense; TATCGCCCAATCTCCGGATGATGGT
>probe:Drosophila_2:1640970_at:29:377; Interrogation_Position=2270; Antisense; GAAGAAGCAGCTGTATCTCGACCAG
>probe:Drosophila_2:1640970_at:400:383; Interrogation_Position=2294; Antisense; GAACACCCTCCAGATTGGCAAGTTG
>probe:Drosophila_2:1640970_at:282:467; Interrogation_Position=2315; Antisense; GTTGGAGAAGCTGCTTTCCCTGGTG
>probe:Drosophila_2:1640970_at:656:561; Interrogation_Position=2351; Antisense; GGAAGGTTCAACTGCGGTGCCCGAT
>probe:Drosophila_2:1640970_at:693:445; Interrogation_Position=2373; Antisense; GATGCAGCCACAACCGTGCGAAGTT
>probe:Drosophila_2:1640970_at:447:209; Interrogation_Position=2488; Antisense; AAGAATCCTGATTCATCCGTCTTGT
>probe:Drosophila_2:1640970_at:85:13; Interrogation_Position=2498; Antisense; ATTCATCCGTCTTGTGTTACGCTAT
>probe:Drosophila_2:1640970_at:523:475; Interrogation_Position=2513; Antisense; GTTACGCTATGTTTCTATCCATCTA

Paste this into a BLAST search page for me
GTCCACGTTTTCGACCTAAATGTGAATCCAGGCCGTGGTGCCCAAGCGAAGAACAAGCTCACCAGGTTATCCTTCGAGAAGCTCGCCTTCATTGTGGTGGAGAAGGGCGTCACCACTTCGCTGAATATCGCCCAATCTCCGGATGATGGTGAAGAAGCAGCTGTATCTCGACCAGGAACACCCTCCAGATTGGCAAGTTGGTTGGAGAAGCTGCTTTCCCTGGTGGGAAGGTTCAACTGCGGTGCCCGATGATGCAGCCACAACCGTGCGAAGTTAAGAATCCTGATTCATCCGTCTTGTATTCATCCGTCTTGTGTTACGCTATGTTACGCTATGTTTCTATCCATCTA

Full Affymetrix probeset data:

Annotations for 1640970_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720