FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640972_at:

>probe:Drosophila_2:1640972_at:216:401; Interrogation_Position=1017; Antisense; GACTACGGTAGTCCCTCTGTTCAGA
>probe:Drosophila_2:1640972_at:84:201; Interrogation_Position=1044; Antisense; AACCAGAGTTTAGCCAGTCCCGATT
>probe:Drosophila_2:1640972_at:115:437; Interrogation_Position=1077; Antisense; GAGGAGTCCTTCACTGAGAACACAA
>probe:Drosophila_2:1640972_at:125:387; Interrogation_Position=1094; Antisense; GAACACAAACCTGGTGGTCTCCGAT
>probe:Drosophila_2:1640972_at:139:591; Interrogation_Position=1108; Antisense; TGGTCTCCGATGAAGTGGTCACAGT
>probe:Drosophila_2:1640972_at:465:245; Interrogation_Position=1148; Antisense; AATTACCGTGCAGCTGCAGGATCCA
>probe:Drosophila_2:1640972_at:131:637; Interrogation_Position=1185; Antisense; TCGACTTTCCTTCCCAAAGAGCAAA
>probe:Drosophila_2:1640972_at:46:623; Interrogation_Position=1224; Antisense; TCGCGCTTTGAAGACGATACCGAAA
>probe:Drosophila_2:1640972_at:357:457; Interrogation_Position=1239; Antisense; GATACCGAAAACCAGCACCCATTGA
>probe:Drosophila_2:1640972_at:126:275; Interrogation_Position=919; Antisense; CGGAGTACCTAGTTGGACTGACCTC
>probe:Drosophila_2:1640972_at:559:405; Interrogation_Position=934; Antisense; GACTGACCTCCTATACTGAGGCGAA
>probe:Drosophila_2:1640972_at:100:285; Interrogation_Position=949; Antisense; CTGAGGCGAATGTCGAGCCGTACAT
>probe:Drosophila_2:1640972_at:443:489; Interrogation_Position=968; Antisense; GTACATGAACGTTCTGACCGACTAT
>probe:Drosophila_2:1640972_at:616:671; Interrogation_Position=999; Antisense; TACCATGTTATTCAGACCGACTACG

Paste this into a BLAST search page for me
GACTACGGTAGTCCCTCTGTTCAGAAACCAGAGTTTAGCCAGTCCCGATTGAGGAGTCCTTCACTGAGAACACAAGAACACAAACCTGGTGGTCTCCGATTGGTCTCCGATGAAGTGGTCACAGTAATTACCGTGCAGCTGCAGGATCCATCGACTTTCCTTCCCAAAGAGCAAATCGCGCTTTGAAGACGATACCGAAAGATACCGAAAACCAGCACCCATTGACGGAGTACCTAGTTGGACTGACCTCGACTGACCTCCTATACTGAGGCGAACTGAGGCGAATGTCGAGCCGTACATGTACATGAACGTTCTGACCGACTATTACCATGTTATTCAGACCGACTACG

Full Affymetrix probeset data:

Annotations for 1640972_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720