FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640975_at:

>probe:Drosophila_2:1640975_at:502:35; Interrogation_Position=14; Antisense; ATCAGAGGGCATCATTCGTCGCGAA
>probe:Drosophila_2:1640975_at:122:299; Interrogation_Position=388; Antisense; CCGTGGCCTAAGTGAAATTGCTTTG
>probe:Drosophila_2:1640975_at:236:217; Interrogation_Position=397; Antisense; AAGTGAAATTGCTTTGACCTTTAGC
>probe:Drosophila_2:1640975_at:403:411; Interrogation_Position=412; Antisense; GACCTTTAGCAATTTTAAAGCCATA
>probe:Drosophila_2:1640975_at:214:663; Interrogation_Position=427; Antisense; TAAAGCCATACTATCCAACTCCTTG
>probe:Drosophila_2:1640975_at:37:313; Interrogation_Position=431; Antisense; GCCATACTATCCAACTCCTTGTTAA
>probe:Drosophila_2:1640975_at:519:603; Interrogation_Position=440; Antisense; TCCAACTCCTTGTTAATAGCCCCAA
>probe:Drosophila_2:1640975_at:367:425; Interrogation_Position=456; Antisense; TAGCCCCAAACATTACCAAACCAAT
>probe:Drosophila_2:1640975_at:162:657; Interrogation_Position=468; Antisense; TTACCAAACCAATCCTATCCCTGTT
>probe:Drosophila_2:1640975_at:229:309; Interrogation_Position=476; Antisense; CCAATCCTATCCCTGTTTTCAAAGG
>probe:Drosophila_2:1640975_at:37:307; Interrogation_Position=481; Antisense; CCTATCCCTGTTTTCAAAGGATGGG
>probe:Drosophila_2:1640975_at:313:527; Interrogation_Position=503; Antisense; GGGAACTAAGTCAACCAGCACCACT
>probe:Drosophila_2:1640975_at:76:219; Interrogation_Position=510; Antisense; AAGTCAACCAGCACCACTTGTTAAA
>probe:Drosophila_2:1640975_at:228:129; Interrogation_Position=516; Antisense; ACCAGCACCACTTGTTAAATATTAA

Paste this into a BLAST search page for me
ATCAGAGGGCATCATTCGTCGCGAACCGTGGCCTAAGTGAAATTGCTTTGAAGTGAAATTGCTTTGACCTTTAGCGACCTTTAGCAATTTTAAAGCCATATAAAGCCATACTATCCAACTCCTTGGCCATACTATCCAACTCCTTGTTAATCCAACTCCTTGTTAATAGCCCCAATAGCCCCAAACATTACCAAACCAATTTACCAAACCAATCCTATCCCTGTTCCAATCCTATCCCTGTTTTCAAAGGCCTATCCCTGTTTTCAAAGGATGGGGGGAACTAAGTCAACCAGCACCACTAAGTCAACCAGCACCACTTGTTAAAACCAGCACCACTTGTTAAATATTAA

Full Affymetrix probeset data:

Annotations for 1640975_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720