FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640976_at:

>probe:Drosophila_2:1640976_at:711:467; Interrogation_Position=1089; Antisense; GTTGCCAGTTACGATAGTCCGCTAA
>probe:Drosophila_2:1640976_at:46:661; Interrogation_Position=1111; Antisense; TAACCCAATGTCTACCTGTCTGTAT
>probe:Drosophila_2:1640976_at:531:499; Interrogation_Position=1128; Antisense; GTCTGTATATGTCTACGCTTTGGAT
>probe:Drosophila_2:1640976_at:536:461; Interrogation_Position=1180; Antisense; GATTACGATCTAAACCCATGTGCTT
>probe:Drosophila_2:1640976_at:363:239; Interrogation_Position=1210; Antisense; AATCTTCTCTTCACTTATGTGTTGG
>probe:Drosophila_2:1640976_at:577:695; Interrogation_Position=1224; Antisense; TTATGTGTTGGCACGGCGGTCCAAA
>probe:Drosophila_2:1640976_at:203:161; Interrogation_Position=1247; Antisense; AAATTGGCCCTTTGCTAGCTATTGA
>probe:Drosophila_2:1640976_at:345:341; Interrogation_Position=1264; Antisense; GCTATTGATGTTGTGGGCCTTCTTA
>probe:Drosophila_2:1640976_at:540:307; Interrogation_Position=1295; Antisense; CCACGGCGGATCTATGTATACCAAT
>probe:Drosophila_2:1640976_at:279:249; Interrogation_Position=1316; Antisense; CAATCGGATCGGAAGGCTGCACCTA
>probe:Drosophila_2:1640976_at:338:227; Interrogation_Position=1328; Antisense; AAGGCTGCACCTATGTATACACATG
>probe:Drosophila_2:1640976_at:15:687; Interrogation_Position=1343; Antisense; TATACACATGCAGTCGCACTTCCGA
>probe:Drosophila_2:1640976_at:42:185; Interrogation_Position=973; Antisense; AACTCCAAGGGAGCGGTGCGACTTG
>probe:Drosophila_2:1640976_at:455:325; Interrogation_Position=990; Antisense; GCGACTTGGGCTTTGATGATTGCTT

Paste this into a BLAST search page for me
GTTGCCAGTTACGATAGTCCGCTAATAACCCAATGTCTACCTGTCTGTATGTCTGTATATGTCTACGCTTTGGATGATTACGATCTAAACCCATGTGCTTAATCTTCTCTTCACTTATGTGTTGGTTATGTGTTGGCACGGCGGTCCAAAAAATTGGCCCTTTGCTAGCTATTGAGCTATTGATGTTGTGGGCCTTCTTACCACGGCGGATCTATGTATACCAATCAATCGGATCGGAAGGCTGCACCTAAAGGCTGCACCTATGTATACACATGTATACACATGCAGTCGCACTTCCGAAACTCCAAGGGAGCGGTGCGACTTGGCGACTTGGGCTTTGATGATTGCTT

Full Affymetrix probeset data:

Annotations for 1640976_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720