FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640977_at:

>probe:Drosophila_2:1640977_at:107:337; Interrogation_Position=1017; Antisense; GCTGCGGAACTTTCTTTGCGTGAGA
>probe:Drosophila_2:1640977_at:469:583; Interrogation_Position=1059; Antisense; TGGGTGGACTTTCTATCCAATCGCC
>probe:Drosophila_2:1640977_at:11:153; Interrogation_Position=1090; Antisense; ACAGGATTTCAAGTGCCTTGCCGCA
>probe:Drosophila_2:1640977_at:577:627; Interrogation_Position=1103; Antisense; TGCCTTGCCGCATGTCATCAGGAAT
>probe:Drosophila_2:1640977_at:79:593; Interrogation_Position=1127; Antisense; TGGTGATGCCAAAGCCACATACAAT
>probe:Drosophila_2:1640977_at:126:719; Interrogation_Position=1154; Antisense; TTGCCTGAATTTGTCGTTTGCCTAT
>probe:Drosophila_2:1640977_at:279:695; Interrogation_Position=1170; Antisense; TTTGCCTATGTCGAGGGCGAGTCAC
>probe:Drosophila_2:1640977_at:571:575; Interrogation_Position=1185; Antisense; GGCGAGTCACTACTGATGGCTCTTA
>probe:Drosophila_2:1640977_at:71:69; Interrogation_Position=1200; Antisense; ATGGCTCTTAAGGACGTGGCCCTGA
>probe:Drosophila_2:1640977_at:172:27; Interrogation_Position=1314; Antisense; ATACGCTTTGGCATCGGGCGCTTTA
>probe:Drosophila_2:1640977_at:714:403; Interrogation_Position=1356; Antisense; GACTACACCGCCGATAAGTGCATCA
>probe:Drosophila_2:1640977_at:192:525; Interrogation_Position=1433; Antisense; GGGCATCGACCTAAAGACCATCCAA
>probe:Drosophila_2:1640977_at:703:127; Interrogation_Position=1449; Antisense; ACCATCCAATGGTCGCAGCATTAAT
>probe:Drosophila_2:1640977_at:27:661; Interrogation_Position=1484; Antisense; TTAAGCCGTTACTGTTACACCACAC

Paste this into a BLAST search page for me
GCTGCGGAACTTTCTTTGCGTGAGATGGGTGGACTTTCTATCCAATCGCCACAGGATTTCAAGTGCCTTGCCGCATGCCTTGCCGCATGTCATCAGGAATTGGTGATGCCAAAGCCACATACAATTTGCCTGAATTTGTCGTTTGCCTATTTTGCCTATGTCGAGGGCGAGTCACGGCGAGTCACTACTGATGGCTCTTAATGGCTCTTAAGGACGTGGCCCTGAATACGCTTTGGCATCGGGCGCTTTAGACTACACCGCCGATAAGTGCATCAGGGCATCGACCTAAAGACCATCCAAACCATCCAATGGTCGCAGCATTAATTTAAGCCGTTACTGTTACACCACAC

Full Affymetrix probeset data:

Annotations for 1640977_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720