FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640978_at:

>probe:Drosophila_2:1640978_at:573:371; Interrogation_Position=111; Antisense; GAAGGACAAGTACCACGCAACTCAA
>probe:Drosophila_2:1640978_at:451:649; Interrogation_Position=155; Antisense; TCACCGGAGTGGACATAGCTACGAG
>probe:Drosophila_2:1640978_at:99:693; Interrogation_Position=181; Antisense; TTTGGAGAGCCATCCAGTTCGCAGA
>probe:Drosophila_2:1640978_at:496:351; Interrogation_Position=201; Antisense; GCAGAGGCCAGCTCTAGTCAATCTA
>probe:Drosophila_2:1640978_at:462:89; Interrogation_Position=216; Antisense; AGTCAATCTACCGTTTGGAGCCTCC
>probe:Drosophila_2:1640978_at:654:107; Interrogation_Position=242; Antisense; AGAAGCCGCCGATTGGAGTTCCCCT
>probe:Drosophila_2:1640978_at:420:91; Interrogation_Position=258; Antisense; AGTTCCCCTAGTACTGCCAATAAGT
>probe:Drosophila_2:1640978_at:193:101; Interrogation_Position=330; Antisense; AGAGGACAGTCCACAGTTCACAACG
>probe:Drosophila_2:1640978_at:504:43; Interrogation_Position=421; Antisense; ATCGATGCCCATGGTGACCGCGAGT
>probe:Drosophila_2:1640978_at:268:517; Interrogation_Position=444; Antisense; GTGGGTCAACCACTTGAGTCAGCTG
>probe:Drosophila_2:1640978_at:618:353; Interrogation_Position=480; Antisense; GCAGCCCTTCTGGTTCATTAATTAC
>probe:Drosophila_2:1640978_at:184:387; Interrogation_Position=49; Antisense; GAAAATATTCGAGCCCAACGGCCCT
>probe:Drosophila_2:1640978_at:692:313; Interrogation_Position=508; Antisense; GCCATTGAGGCCCATCGGAATAGCT
>probe:Drosophila_2:1640978_at:448:275; Interrogation_Position=75; Antisense; CTTTGCGGGATTGAGGCCACCAGGT

Paste this into a BLAST search page for me
GAAGGACAAGTACCACGCAACTCAATCACCGGAGTGGACATAGCTACGAGTTTGGAGAGCCATCCAGTTCGCAGAGCAGAGGCCAGCTCTAGTCAATCTAAGTCAATCTACCGTTTGGAGCCTCCAGAAGCCGCCGATTGGAGTTCCCCTAGTTCCCCTAGTACTGCCAATAAGTAGAGGACAGTCCACAGTTCACAACGATCGATGCCCATGGTGACCGCGAGTGTGGGTCAACCACTTGAGTCAGCTGGCAGCCCTTCTGGTTCATTAATTACGAAAATATTCGAGCCCAACGGCCCTGCCATTGAGGCCCATCGGAATAGCTCTTTGCGGGATTGAGGCCACCAGGT

Full Affymetrix probeset data:

Annotations for 1640978_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720