Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640979_at:

>probe:Drosophila_2:1640979_at:157:605; Interrogation_Position=1038; Antisense; TGATTATACTTGCTCTTCCTATCCA
>probe:Drosophila_2:1640979_at:62:127; Interrogation_Position=1072; Antisense; AGCCTTTCCATCACACTTGTTTTAA
>probe:Drosophila_2:1640979_at:292:579; Interrogation_Position=529; Antisense; GGCCTGGCAGCAGACCAACATGGGT
>probe:Drosophila_2:1640979_at:509:311; Interrogation_Position=557; Antisense; GCCACCACGGAGTATTTCCAGCAAA
>probe:Drosophila_2:1640979_at:260:171; Interrogation_Position=580; Antisense; AAAGTGGCTGGTGCCGTATCTGCAA
>probe:Drosophila_2:1640979_at:331:233; Interrogation_Position=623; Antisense; AATGCGGTGAATCTCGCCAGCAAGC
>probe:Drosophila_2:1640979_at:594:293; Interrogation_Position=667; Antisense; CGAGTTCGAACAGCTATTCCTCAAC
>probe:Drosophila_2:1640979_at:57:195; Interrogation_Position=689; Antisense; AACTCCCGCAAGTTCATGATGGGCG
>probe:Drosophila_2:1640979_at:156:19; Interrogation_Position=719; Antisense; ATTTCGTATGCGGATCTCAGCGCCA
>probe:Drosophila_2:1640979_at:533:159; Interrogation_Position=798; Antisense; ACAAGCTGGCGCGTTGGTATGAAAC
>probe:Drosophila_2:1640979_at:607:77; Interrogation_Position=834; Antisense; AGCTGGGTCCCCACTACAAGGAGGT
>probe:Drosophila_2:1640979_at:359:377; Interrogation_Position=928; Antisense; GAAGCAATAGCTAGGACCGTCCGCC
>probe:Drosophila_2:1640979_at:200:503; Interrogation_Position=946; Antisense; GTCCGCCGCCAATATTGTTTAGTTC
>probe:Drosophila_2:1640979_at:211:471; Interrogation_Position=967; Antisense; GTTCCCTAAGGCAATCGACTATTTA

Paste this into a BLAST search page for me
TGATTATACTTGCTCTTCCTATCCAAGCCTTTCCATCACACTTGTTTTAAGGCCTGGCAGCAGACCAACATGGGTGCCACCACGGAGTATTTCCAGCAAAAAAGTGGCTGGTGCCGTATCTGCAAAATGCGGTGAATCTCGCCAGCAAGCCGAGTTCGAACAGCTATTCCTCAACAACTCCCGCAAGTTCATGATGGGCGATTTCGTATGCGGATCTCAGCGCCAACAAGCTGGCGCGTTGGTATGAAACAGCTGGGTCCCCACTACAAGGAGGTGAAGCAATAGCTAGGACCGTCCGCCGTCCGCCGCCAATATTGTTTAGTTCGTTCCCTAAGGCAATCGACTATTTA

Full Affymetrix probeset data:

Annotations for 1640979_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime