Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640980_at:

>probe:Drosophila_2:1640980_at:569:621; Interrogation_Position=1600; Antisense; TGCGACGGGCGGACAGAATCACAAT
>probe:Drosophila_2:1640980_at:36:263; Interrogation_Position=1648; Antisense; CAGCATTAGCATTGGCTCGAAGCCA
>probe:Drosophila_2:1640980_at:450:421; Interrogation_Position=1723; Antisense; GAGTAAGAATTTCTCGCGCACCTCA
>probe:Drosophila_2:1640980_at:415:489; Interrogation_Position=1799; Antisense; GTGACCAACTCCCTGGAACTGGGCG
>probe:Drosophila_2:1640980_at:237:19; Interrogation_Position=1854; Antisense; ATTTGGACGATGTTTGCCTCAACGA
>probe:Drosophila_2:1640980_at:659:511; Interrogation_Position=1883; Antisense; GTGACCAACACCAATACCAGTTCAG
>probe:Drosophila_2:1640980_at:668:471; Interrogation_Position=1902; Antisense; GTTCAGCCGTCCAGGAGGTTTACCA
>probe:Drosophila_2:1640980_at:552:419; Interrogation_Position=1928; Antisense; GAGCAGGACCTGGTGCGCAGCCAAC
>probe:Drosophila_2:1640980_at:431:311; Interrogation_Position=1947; Antisense; GCCAACCGGATTTGATGCTGCTCAA
>probe:Drosophila_2:1640980_at:221:607; Interrogation_Position=1959; Antisense; TGATGCTGCTCAACAATTCCGGCGA
>probe:Drosophila_2:1640980_at:215:141; Interrogation_Position=1983; Antisense; ACGGAGTGACAAGTGCCAAGGCTAA
>probe:Drosophila_2:1640980_at:230:571; Interrogation_Position=2002; Antisense; GGCTAAGAAGGCCACCCAGCGATTG
>probe:Drosophila_2:1640980_at:484:135; Interrogation_Position=2036; Antisense; ACGCACAAGCGTTCCGAATCGGAGC
>probe:Drosophila_2:1640980_at:685:547; Interrogation_Position=2108; Antisense; GGAGGCAACCAAACGACACAGCTGT

Paste this into a BLAST search page for me
TGCGACGGGCGGACAGAATCACAATCAGCATTAGCATTGGCTCGAAGCCAGAGTAAGAATTTCTCGCGCACCTCAGTGACCAACTCCCTGGAACTGGGCGATTTGGACGATGTTTGCCTCAACGAGTGACCAACACCAATACCAGTTCAGGTTCAGCCGTCCAGGAGGTTTACCAGAGCAGGACCTGGTGCGCAGCCAACGCCAACCGGATTTGATGCTGCTCAATGATGCTGCTCAACAATTCCGGCGAACGGAGTGACAAGTGCCAAGGCTAAGGCTAAGAAGGCCACCCAGCGATTGACGCACAAGCGTTCCGAATCGGAGCGGAGGCAACCAAACGACACAGCTGT

Full Affymetrix probeset data:

Annotations for 1640980_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime