FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640981_at:

>probe:Drosophila_2:1640981_at:357:311; Interrogation_Position=225; Antisense; GCCAATTAACGATTTCATCTCATGT
>probe:Drosophila_2:1640981_at:277:237; Interrogation_Position=276; Antisense; AATCGTTAGCATTCACCAAGTTGTA
>probe:Drosophila_2:1640981_at:263:215; Interrogation_Position=301; Antisense; AAGATGCACGGAACGCACTTTTTGA
>probe:Drosophila_2:1640981_at:472:199; Interrogation_Position=312; Antisense; AACGCACTTTTTGATCCTGCTTCTG
>probe:Drosophila_2:1640981_at:622:305; Interrogation_Position=327; Antisense; CCTGCTTCTGTTGTGTGGAGTCCTG
>probe:Drosophila_2:1640981_at:717:629; Interrogation_Position=347; Antisense; TCCTGGGATCTAACGGTGTGACGCC
>probe:Drosophila_2:1640981_at:74:533; Interrogation_Position=361; Antisense; GGTGTGACGCCCGACATTAAAAACG
>probe:Drosophila_2:1640981_at:542:137; Interrogation_Position=437; Antisense; ACGAGCCAATAGTTAAGTCCAGGAT
>probe:Drosophila_2:1640981_at:331:495; Interrogation_Position=453; Antisense; GTCCAGGATTTTAACCTTGCCGCCT
>probe:Drosophila_2:1640981_at:87:307; Interrogation_Position=467; Antisense; CCTTGCCGCCTAACTGTAATCAATA
>probe:Drosophila_2:1640981_at:440:239; Interrogation_Position=484; Antisense; AATCAATATGTTAGCGCGGTCGTCG
>probe:Drosophila_2:1640981_at:442:123; Interrogation_Position=496; Antisense; AGCGCGGTCGTCGAGACTTGGAAAC
>probe:Drosophila_2:1640981_at:16:657; Interrogation_Position=574; Antisense; TAATGCCCAATTAAAACCTAGACCA
>probe:Drosophila_2:1640981_at:518:31; Interrogation_Position=71; Antisense; ATAATTGTCCTGGTATTGGATCGAT

Paste this into a BLAST search page for me
GCCAATTAACGATTTCATCTCATGTAATCGTTAGCATTCACCAAGTTGTAAAGATGCACGGAACGCACTTTTTGAAACGCACTTTTTGATCCTGCTTCTGCCTGCTTCTGTTGTGTGGAGTCCTGTCCTGGGATCTAACGGTGTGACGCCGGTGTGACGCCCGACATTAAAAACGACGAGCCAATAGTTAAGTCCAGGATGTCCAGGATTTTAACCTTGCCGCCTCCTTGCCGCCTAACTGTAATCAATAAATCAATATGTTAGCGCGGTCGTCGAGCGCGGTCGTCGAGACTTGGAAACTAATGCCCAATTAAAACCTAGACCAATAATTGTCCTGGTATTGGATCGAT

Full Affymetrix probeset data:

Annotations for 1640981_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720