Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640983_at:

>probe:Drosophila_2:1640983_at:574:371; Interrogation_Position=1032; Antisense; GAAGGAGACTGTGGCCACCAAGCTC
>probe:Drosophila_2:1640983_at:688:433; Interrogation_Position=1090; Antisense; GAGTGTCGCCAGTACTACAACAAGG
>probe:Drosophila_2:1640983_at:383:435; Interrogation_Position=1117; Antisense; GAGGTGAGCGACAACCACATCTGCG
>probe:Drosophila_2:1640983_at:465:151; Interrogation_Position=1133; Antisense; ACATCTGCGCCACAGGAACTGGGAT
>probe:Drosophila_2:1640983_at:630:573; Interrogation_Position=1183; Antisense; GGCGGACCGGTGTTCTTCAAGCATC
>probe:Drosophila_2:1640983_at:558:105; Interrogation_Position=1214; Antisense; AGAACACCTACCGAGTGGTCCAGTA
>probe:Drosophila_2:1640983_at:200:331; Interrogation_Position=1268; Antisense; GCGGACAGAACCAGCCAGGAGTCTT
>probe:Drosophila_2:1640983_at:273:77; Interrogation_Position=1284; Antisense; AGGAGTCTTCGCCAGTGTCATCGAC
>probe:Drosophila_2:1640983_at:431:589; Interrogation_Position=1318; Antisense; TGGATCACGCAGAACCTTCAGTAGT
>probe:Drosophila_2:1640983_at:231:13; Interrogation_Position=1409; Antisense; ATTCTTGCCGCAGGATTATCTAGAT
>probe:Drosophila_2:1640983_at:166:215; Interrogation_Position=883; Antisense; AAGATCAGCCATGACGTTGCCATCA
>probe:Drosophila_2:1640983_at:416:647; Interrogation_Position=905; Antisense; TCATCAAGCTGGATCGCGTGGTCAA
>probe:Drosophila_2:1640983_at:722:477; Interrogation_Position=952; Antisense; GTTTGCCTGCCAATCGACCAGAAGT
>probe:Drosophila_2:1640983_at:165:587; Interrogation_Position=986; Antisense; TGGACTTCGATCAGAGCTTCTTCGT

Paste this into a BLAST search page for me
GAAGGAGACTGTGGCCACCAAGCTCGAGTGTCGCCAGTACTACAACAAGGGAGGTGAGCGACAACCACATCTGCGACATCTGCGCCACAGGAACTGGGATGGCGGACCGGTGTTCTTCAAGCATCAGAACACCTACCGAGTGGTCCAGTAGCGGACAGAACCAGCCAGGAGTCTTAGGAGTCTTCGCCAGTGTCATCGACTGGATCACGCAGAACCTTCAGTAGTATTCTTGCCGCAGGATTATCTAGATAAGATCAGCCATGACGTTGCCATCATCATCAAGCTGGATCGCGTGGTCAAGTTTGCCTGCCAATCGACCAGAAGTTGGACTTCGATCAGAGCTTCTTCGT

Full Affymetrix probeset data:

Annotations for 1640983_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime