FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640986_at:

>probe:Drosophila_2:1640986_at:187:131; Interrogation_Position=1050; Antisense; ACCTCCACCACGAGATGAGTACGTT
>probe:Drosophila_2:1640986_at:442:627; Interrogation_Position=1089; Antisense; TGCCATGAGGCCTGGAGACGGATAC
>probe:Drosophila_2:1640986_at:660:543; Interrogation_Position=1108; Antisense; GGATACGGTGGTTACGACGATGACA
>probe:Drosophila_2:1640986_at:211:565; Interrogation_Position=1175; Antisense; GGAATAACAACCGACCAATGCCCAG
>probe:Drosophila_2:1640986_at:284:51; Interrogation_Position=1192; Antisense; ATGCCCAGCGATAGAGATAGAGACC
>probe:Drosophila_2:1640986_at:20:559; Interrogation_Position=1224; Antisense; GGACAGACTTGGTTATCCCATGGAT
>probe:Drosophila_2:1640986_at:529:271; Interrogation_Position=669; Antisense; CATCTTTGGATTGGGCTACGGGAAT
>probe:Drosophila_2:1640986_at:91:367; Interrogation_Position=690; Antisense; GAATGGTTATAGCTACGGATCCCCG
>probe:Drosophila_2:1640986_at:421:425; Interrogation_Position=715; Antisense; GAGAGATATACACCGCCGACAGGGA
>probe:Drosophila_2:1640986_at:191:153; Interrogation_Position=733; Antisense; ACAGGGAGGCCATCGAGTGGTTCTT
>probe:Drosophila_2:1640986_at:429:83; Interrogation_Position=748; Antisense; AGTGGTTCTTCGGAGGAGCGACCCA
>probe:Drosophila_2:1640986_at:172:397; Interrogation_Position=798; Antisense; GACAGCCGATCGTCCGGAATATCCG
>probe:Drosophila_2:1640986_at:343:669; Interrogation_Position=840; Antisense; TACGGCCGATCGTCCGGAGTATCCA
>probe:Drosophila_2:1640986_at:420:475; Interrogation_Position=995; Antisense; GTTACGGAATGAATGGCCCATCGGC

Paste this into a BLAST search page for me
ACCTCCACCACGAGATGAGTACGTTTGCCATGAGGCCTGGAGACGGATACGGATACGGTGGTTACGACGATGACAGGAATAACAACCGACCAATGCCCAGATGCCCAGCGATAGAGATAGAGACCGGACAGACTTGGTTATCCCATGGATCATCTTTGGATTGGGCTACGGGAATGAATGGTTATAGCTACGGATCCCCGGAGAGATATACACCGCCGACAGGGAACAGGGAGGCCATCGAGTGGTTCTTAGTGGTTCTTCGGAGGAGCGACCCAGACAGCCGATCGTCCGGAATATCCGTACGGCCGATCGTCCGGAGTATCCAGTTACGGAATGAATGGCCCATCGGC

Full Affymetrix probeset data:

Annotations for 1640986_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720