FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640987_at:

>probe:Drosophila_2:1640987_at:588:627; Interrogation_Position=3350; Antisense; TGCCACAGGCGGGTTACCAGGTGAC
>probe:Drosophila_2:1640987_at:370:595; Interrogation_Position=3394; Antisense; TGGGCCCAGATAGCCGATGTCATGG
>probe:Drosophila_2:1640987_at:273:443; Interrogation_Position=3409; Antisense; GATGTCATGGCGCAAACGAATCACT
>probe:Drosophila_2:1640987_at:720:427; Interrogation_Position=3474; Antisense; GATGTTTGCCTACCCGAACTTGGGC
>probe:Drosophila_2:1640987_at:572:547; Interrogation_Position=3524; Antisense; GGATGTCTCTGCAGAGCACCATGCA
>probe:Drosophila_2:1640987_at:368:7; Interrogation_Position=3585; Antisense; ATTGCCCAGAAGACTTGGCCTTGGT
>probe:Drosophila_2:1640987_at:639:727; Interrogation_Position=3605; Antisense; TTGGTCCCCGCTCGAATGGAATGCG
>probe:Drosophila_2:1640987_at:270:67; Interrogation_Position=3620; Antisense; ATGGAATGCGCACACTGGAGAACTC
>probe:Drosophila_2:1640987_at:450:45; Interrogation_Position=3665; Antisense; ATCGCGCCGATTTGCTGGGACGCAA
>probe:Drosophila_2:1640987_at:681:377; Interrogation_Position=3735; Antisense; GAACCAATCTGGCATCTACTACGAT
>probe:Drosophila_2:1640987_at:452:587; Interrogation_Position=3803; Antisense; TGGACCACCTGTACGGGTCGCAAAA
>probe:Drosophila_2:1640987_at:534:185; Interrogation_Position=3824; Antisense; AAAATCAGTCCGTGACGCACTCATC
>probe:Drosophila_2:1640987_at:300:83; Interrogation_Position=3875; Antisense; AGGGCATCCCGATGAGCACGTACAC
>probe:Drosophila_2:1640987_at:466:337; Interrogation_Position=3910; Antisense; GCTCCCAGCAGCTACTACATGAAGT

Paste this into a BLAST search page for me
TGCCACAGGCGGGTTACCAGGTGACTGGGCCCAGATAGCCGATGTCATGGGATGTCATGGCGCAAACGAATCACTGATGTTTGCCTACCCGAACTTGGGCGGATGTCTCTGCAGAGCACCATGCAATTGCCCAGAAGACTTGGCCTTGGTTTGGTCCCCGCTCGAATGGAATGCGATGGAATGCGCACACTGGAGAACTCATCGCGCCGATTTGCTGGGACGCAAGAACCAATCTGGCATCTACTACGATTGGACCACCTGTACGGGTCGCAAAAAAAATCAGTCCGTGACGCACTCATCAGGGCATCCCGATGAGCACGTACACGCTCCCAGCAGCTACTACATGAAGT

Full Affymetrix probeset data:

Annotations for 1640987_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720