FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640988_at:

>probe:Drosophila_2:1640988_at:147:381; Interrogation_Position=2781; Antisense; GAACGAGCGCGACTTCTTCGAGGTC
>probe:Drosophila_2:1640988_at:157:667; Interrogation_Position=2824; Antisense; TACATATCCTACGAGCTGGGCAACT
>probe:Drosophila_2:1640988_at:31:619; Interrogation_Position=2857; Antisense; TGCATCGAAGCATTGTCCTTTCCAT
>probe:Drosophila_2:1640988_at:529:145; Interrogation_Position=2895; Antisense; ACTCTCCATTGTGGCCAACTATATG
>probe:Drosophila_2:1640988_at:535:663; Interrogation_Position=2935; Antisense; TACAAACTGGACCTCTTGGACCTGG
>probe:Drosophila_2:1640988_at:345:479; Interrogation_Position=3017; Antisense; GTTTCCTGGCGCTGATTAACCTGAG
>probe:Drosophila_2:1640988_at:686:653; Interrogation_Position=3033; Antisense; TAACCTGAGGCTGGGCGAGAACTAC
>probe:Drosophila_2:1640988_at:440:147; Interrogation_Position=3053; Antisense; ACTACAAGGCCATCGAGTGCTGGAA
>probe:Drosophila_2:1640988_at:188:453; Interrogation_Position=3120; Antisense; GATCTATGAGGAACTGGACGCCATC
>probe:Drosophila_2:1640988_at:590:43; Interrogation_Position=3142; Antisense; ATCGACTATGACTCCGTTGACCTGT
>probe:Drosophila_2:1640988_at:704:467; Interrogation_Position=3157; Antisense; GTTGACCTGTACATAGATGCACCCA
>probe:Drosophila_2:1640988_at:317:401; Interrogation_Position=3196; Antisense; GACATCTTTAGGGACTCGCAATCGG
>probe:Drosophila_2:1640988_at:360:31; Interrogation_Position=3251; Antisense; ATAAAGACCGACATTCTGGCTGCGC
>probe:Drosophila_2:1640988_at:424:9; Interrogation_Position=3263; Antisense; ATTCTGGCTGCGCTGCTAAAATGGC

Paste this into a BLAST search page for me
GAACGAGCGCGACTTCTTCGAGGTCTACATATCCTACGAGCTGGGCAACTTGCATCGAAGCATTGTCCTTTCCATACTCTCCATTGTGGCCAACTATATGTACAAACTGGACCTCTTGGACCTGGGTTTCCTGGCGCTGATTAACCTGAGTAACCTGAGGCTGGGCGAGAACTACACTACAAGGCCATCGAGTGCTGGAAGATCTATGAGGAACTGGACGCCATCATCGACTATGACTCCGTTGACCTGTGTTGACCTGTACATAGATGCACCCAGACATCTTTAGGGACTCGCAATCGGATAAAGACCGACATTCTGGCTGCGCATTCTGGCTGCGCTGCTAAAATGGC

Full Affymetrix probeset data:

Annotations for 1640988_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720