FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640989_at:

>probe:Drosophila_2:1640989_at:190:109; Interrogation_Position=116; Antisense; AGAAGGCCAACCTTGCGGGTCGCAA
>probe:Drosophila_2:1640989_at:715:105; Interrogation_Position=206; Antisense; AGAACGACTGGGTTTGCGACTGCGC
>probe:Drosophila_2:1640989_at:435:255; Interrogation_Position=237; Antisense; CACACTGTATTACCCGGAGACCGAT
>probe:Drosophila_2:1640989_at:199:427; Interrogation_Position=328; Antisense; GAGATCATCCCGAAGTGCGTACGAA
>probe:Drosophila_2:1640989_at:282:605; Interrogation_Position=35; Antisense; TGATCGCCGCGCTTATTGCGTTTAT
>probe:Drosophila_2:1640989_at:322:557; Interrogation_Position=366; Antisense; GGACGGACACTTTATGATTCGCGAC
>probe:Drosophila_2:1640989_at:44:465; Interrogation_Position=381; Antisense; GATTCGCGACACATGCTATGAGTTC
>probe:Drosophila_2:1640989_at:353:69; Interrogation_Position=446; Antisense; AGGCTTCCTTTGTACTTGGCGTGAA
>probe:Drosophila_2:1640989_at:219:583; Interrogation_Position=462; Antisense; TGGCGTGAATCCCACCAACTTGATG
>probe:Drosophila_2:1640989_at:261:407; Interrogation_Position=490; Antisense; GACTGTGTGAAGCTGTCCGTTCAAC
>probe:Drosophila_2:1640989_at:13:197; Interrogation_Position=512; Antisense; AACTGGAGACGCGTATTTCGGACAC
>probe:Drosophila_2:1640989_at:202:363; Interrogation_Position=553; Antisense; GAATACTACGTTGATTTGGCCGAGA
>probe:Drosophila_2:1640989_at:83:21; Interrogation_Position=566; Antisense; ATTTGGCCGAGAAATGCGCACGCGG
>probe:Drosophila_2:1640989_at:209:569; Interrogation_Position=589; Antisense; GGCAGTCGCCTAATGGCTCAGGGAA

Paste this into a BLAST search page for me
AGAAGGCCAACCTTGCGGGTCGCAAAGAACGACTGGGTTTGCGACTGCGCCACACTGTATTACCCGGAGACCGATGAGATCATCCCGAAGTGCGTACGAATGATCGCCGCGCTTATTGCGTTTATGGACGGACACTTTATGATTCGCGACGATTCGCGACACATGCTATGAGTTCAGGCTTCCTTTGTACTTGGCGTGAATGGCGTGAATCCCACCAACTTGATGGACTGTGTGAAGCTGTCCGTTCAACAACTGGAGACGCGTATTTCGGACACGAATACTACGTTGATTTGGCCGAGAATTTGGCCGAGAAATGCGCACGCGGGGCAGTCGCCTAATGGCTCAGGGAA

Full Affymetrix probeset data:

Annotations for 1640989_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720