FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640990_at:

>probe:Drosophila_2:1640990_at:21:299; Interrogation_Position=111; Antisense; CGCATCGATGTTCCAGTTTCTGGAC
>probe:Drosophila_2:1640990_at:423:697; Interrogation_Position=127; Antisense; TTTCTGGACCGCCACAATGGTGAAG
>probe:Drosophila_2:1640990_at:105:615; Interrogation_Position=147; Antisense; TGAAGGCGACCACAGTTGGTCTCAC
>probe:Drosophila_2:1640990_at:481:623; Interrogation_Position=176; Antisense; TGCCCACAAACTTCTACTCCGAGAT
>probe:Drosophila_2:1640990_at:363:713; Interrogation_Position=187; Antisense; TTCTACTCCGAGATGAACCAGCAGT
>probe:Drosophila_2:1640990_at:667:613; Interrogation_Position=200; Antisense; TGAACCAGCAGTACTACAGGAGATT
>probe:Drosophila_2:1640990_at:682:277; Interrogation_Position=213; Antisense; CTACAGGAGATTCCGGCGACAGGCT
>probe:Drosophila_2:1640990_at:197:137; Interrogation_Position=22; Antisense; ACGATGACGTTCTGGTTTCTGGTCT
>probe:Drosophila_2:1640990_at:190:111; Interrogation_Position=241; Antisense; AGAATGGACACCTTCCGATCGGGAA
>probe:Drosophila_2:1640990_at:528:141; Interrogation_Position=267; Antisense; ACGGCAGCAGTACCCTTTTGAATAT
>probe:Drosophila_2:1640990_at:471:581; Interrogation_Position=41; Antisense; TGGTCTTGGCTCTGGTGACCTTAAA
>probe:Drosophila_2:1640990_at:50:513; Interrogation_Position=55; Antisense; GTGACCTTAAATCCAACCTGGCCAT
>probe:Drosophila_2:1640990_at:726:201; Interrogation_Position=69; Antisense; AACCTGGCCATTCTGGCGCACAGGG
>probe:Drosophila_2:1640990_at:265:303; Interrogation_Position=98; Antisense; CCGAAGTCACTTCCGCATCGATGTT

Paste this into a BLAST search page for me
CGCATCGATGTTCCAGTTTCTGGACTTTCTGGACCGCCACAATGGTGAAGTGAAGGCGACCACAGTTGGTCTCACTGCCCACAAACTTCTACTCCGAGATTTCTACTCCGAGATGAACCAGCAGTTGAACCAGCAGTACTACAGGAGATTCTACAGGAGATTCCGGCGACAGGCTACGATGACGTTCTGGTTTCTGGTCTAGAATGGACACCTTCCGATCGGGAAACGGCAGCAGTACCCTTTTGAATATTGGTCTTGGCTCTGGTGACCTTAAAGTGACCTTAAATCCAACCTGGCCATAACCTGGCCATTCTGGCGCACAGGGCCGAAGTCACTTCCGCATCGATGTT

Full Affymetrix probeset data:

Annotations for 1640990_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720