FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640991_at:

>probe:Drosophila_2:1640991_at:643:383; Interrogation_Position=2397; Antisense; GAACTCGACTGCGATGCGATATACT
>probe:Drosophila_2:1640991_at:570:29; Interrogation_Position=2417; Antisense; ATACTGTCATTTTAGCGATCCTCGC
>probe:Drosophila_2:1640991_at:448:281; Interrogation_Position=2437; Antisense; CTCGCGTGCTGCTCAAATTTTTGGA
>probe:Drosophila_2:1640991_at:96:171; Interrogation_Position=2468; Antisense; AAAGGTGTCGATGCTCCATCAGTTC
>probe:Drosophila_2:1640991_at:550:93; Interrogation_Position=2488; Antisense; AGTTCGGATTGCTGGCCATGCTGAT
>probe:Drosophila_2:1640991_at:187:53; Interrogation_Position=2505; Antisense; ATGCTGATGCTGTTCTTCCGAGTGA
>probe:Drosophila_2:1640991_at:475:443; Interrogation_Position=2528; Antisense; GATGATGTACATCAGCCTGCGAAAG
>probe:Drosophila_2:1640991_at:269:293; Interrogation_Position=2553; Antisense; CGATGCTATGCCTGATTTTGAAACC
>probe:Drosophila_2:1640991_at:696:443; Interrogation_Position=2587; Antisense; GATGAATCTTATCCCTAGCTTTAGG
>probe:Drosophila_2:1640991_at:130:495; Interrogation_Position=2616; Antisense; GTCAATGCTGTGATGTTCGATTTTA
>probe:Drosophila_2:1640991_at:233:457; Interrogation_Position=2653; Antisense; GATACTTCCTGTACATACTTATGCA
>probe:Drosophila_2:1640991_at:257:29; Interrogation_Position=2667; Antisense; ATACTTATGCACCATTCCCATGAAA
>probe:Drosophila_2:1640991_at:348:397; Interrogation_Position=2865; Antisense; GACAATCCCCAAGTTGTTTGCAAGG
>probe:Drosophila_2:1640991_at:409:423; Interrogation_Position=2889; Antisense; GAGACGGCTGCACATTTTTTACATT

Paste this into a BLAST search page for me
GAACTCGACTGCGATGCGATATACTATACTGTCATTTTAGCGATCCTCGCCTCGCGTGCTGCTCAAATTTTTGGAAAAGGTGTCGATGCTCCATCAGTTCAGTTCGGATTGCTGGCCATGCTGATATGCTGATGCTGTTCTTCCGAGTGAGATGATGTACATCAGCCTGCGAAAGCGATGCTATGCCTGATTTTGAAACCGATGAATCTTATCCCTAGCTTTAGGGTCAATGCTGTGATGTTCGATTTTAGATACTTCCTGTACATACTTATGCAATACTTATGCACCATTCCCATGAAAGACAATCCCCAAGTTGTTTGCAAGGGAGACGGCTGCACATTTTTTACATT

Full Affymetrix probeset data:

Annotations for 1640991_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720