FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640992_at:

>probe:Drosophila_2:1640992_at:720:291; Interrogation_Position=135; Antisense; CGTTGAAGCGCGGTGAGCCCAATCA
>probe:Drosophila_2:1640992_at:693:589; Interrogation_Position=234; Antisense; TGGTTGTCGGAACCCGCTACAACAT
>probe:Drosophila_2:1640992_at:373:373; Interrogation_Position=314; Antisense; GAAGTGGACGAGACCATGCTCTCCA
>probe:Drosophila_2:1640992_at:609:375; Interrogation_Position=344; Antisense; GACATACTAGAAGACTACCCGGACT
>probe:Drosophila_2:1640992_at:692:671; Interrogation_Position=359; Antisense; TACCCGGACTACTATGATCGCGAGC
>probe:Drosophila_2:1640992_at:486:369; Interrogation_Position=406; Antisense; GAATGAAACCATTCAGTGCTGGCTG
>probe:Drosophila_2:1640992_at:557:85; Interrogation_Position=420; Antisense; AGTGCTGGCTGTACCTGATTCGCAA
>probe:Drosophila_2:1640992_at:278:463; Interrogation_Position=436; Antisense; GATTCGCAACTTCCCAGACAAGATG
>probe:Drosophila_2:1640992_at:458:225; Interrogation_Position=467; Antisense; AAGGAGCTGCTGATCTCGTACCACA
>probe:Drosophila_2:1640992_at:91:91; Interrogation_Position=523; Antisense; AGTACGCACTGTTTCAGCCAGAGAT
>probe:Drosophila_2:1640992_at:609:443; Interrogation_Position=545; Antisense; GATGATCTTTCTTACTGATTTTGCA
>probe:Drosophila_2:1640992_at:165:341; Interrogation_Position=570; Antisense; GCTACTTGGACAGCTGCCCGGAAGA
>probe:Drosophila_2:1640992_at:425:321; Interrogation_Position=585; Antisense; GCCCGGAAGACCTCGCCATGGAAAA
>probe:Drosophila_2:1640992_at:534:195; Interrogation_Position=647; Antisense; AACGGATTTCAACGCATGGGTATTA

Paste this into a BLAST search page for me
CGTTGAAGCGCGGTGAGCCCAATCATGGTTGTCGGAACCCGCTACAACATGAAGTGGACGAGACCATGCTCTCCAGACATACTAGAAGACTACCCGGACTTACCCGGACTACTATGATCGCGAGCGAATGAAACCATTCAGTGCTGGCTGAGTGCTGGCTGTACCTGATTCGCAAGATTCGCAACTTCCCAGACAAGATGAAGGAGCTGCTGATCTCGTACCACAAGTACGCACTGTTTCAGCCAGAGATGATGATCTTTCTTACTGATTTTGCAGCTACTTGGACAGCTGCCCGGAAGAGCCCGGAAGACCTCGCCATGGAAAAAACGGATTTCAACGCATGGGTATTA

Full Affymetrix probeset data:

Annotations for 1640992_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720