Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640993_at:

>probe:Drosophila_2:1640993_at:180:5; Interrogation_Position=289; Antisense; ATAAATTGCCGGTGCCGGTCTTCAA
>probe:Drosophila_2:1640993_at:205:685; Interrogation_Position=327; Antisense; TATTCACCGTCTGCTCTGGAAAGGC
>probe:Drosophila_2:1640993_at:685:313; Interrogation_Position=339; Antisense; GCTCTGGAAAGGCAACTACGCGTGT
>probe:Drosophila_2:1640993_at:14:675; Interrogation_Position=462; Antisense; TAGAATTATTCCTCGCCATTTGCAC
>probe:Drosophila_2:1640993_at:44:399; Interrogation_Position=502; Antisense; GACACGGAGTTAAACATGCTGCTCT
>probe:Drosophila_2:1640993_at:269:575; Interrogation_Position=529; Antisense; GGCGTCACAATTACACAAGGATGCT
>probe:Drosophila_2:1640993_at:203:225; Interrogation_Position=545; Antisense; AAGGATGCTCTCTGTTGCCTAAAAA
>probe:Drosophila_2:1640993_at:414:389; Interrogation_Position=586; Antisense; GAAAAATCTTCGCTTGGCGCTGCCA
>probe:Drosophila_2:1640993_at:655:525; Interrogation_Position=651; Antisense; GGGCAGCCGCAGGTTAGTAGATTTC
>probe:Drosophila_2:1640993_at:728:161; Interrogation_Position=724; Antisense; AAATTGAGGCGAGCCATCGCGCATC
>probe:Drosophila_2:1640993_at:250:607; Interrogation_Position=762; Antisense; TGACCCCAACCTAGTAAGGTCGTCT
>probe:Drosophila_2:1640993_at:74:79; Interrogation_Position=778; Antisense; AGGTCGTCTAATGAAGCGCCTTCCC
>probe:Drosophila_2:1640993_at:609:121; Interrogation_Position=833; Antisense; AGCGGGACCGCAACCGGCGATATGC
>probe:Drosophila_2:1640993_at:201:327; Interrogation_Position=849; Antisense; GCGATATGCCGGGTCCCTAGGATGA

Paste this into a BLAST search page for me
ATAAATTGCCGGTGCCGGTCTTCAATATTCACCGTCTGCTCTGGAAAGGCGCTCTGGAAAGGCAACTACGCGTGTTAGAATTATTCCTCGCCATTTGCACGACACGGAGTTAAACATGCTGCTCTGGCGTCACAATTACACAAGGATGCTAAGGATGCTCTCTGTTGCCTAAAAAGAAAAATCTTCGCTTGGCGCTGCCAGGGCAGCCGCAGGTTAGTAGATTTCAAATTGAGGCGAGCCATCGCGCATCTGACCCCAACCTAGTAAGGTCGTCTAGGTCGTCTAATGAAGCGCCTTCCCAGCGGGACCGCAACCGGCGATATGCGCGATATGCCGGGTCCCTAGGATGA

Full Affymetrix probeset data:

Annotations for 1640993_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime