FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640994_at:

>probe:Drosophila_2:1640994_at:435:35; Interrogation_Position=106; Antisense; ATCAGCGCCATTTTAATCACAGGAG
>probe:Drosophila_2:1640994_at:403:53; Interrogation_Position=13; Antisense; ATGCAAAACCTCTCCATATCCTGCT
>probe:Drosophila_2:1640994_at:328:605; Interrogation_Position=131; Antisense; TGATGTATTTACTGGCGGCGCTCTT
>probe:Drosophila_2:1640994_at:515:645; Interrogation_Position=161; Antisense; TCTTCACGCTCATGATCATTCACTT
>probe:Drosophila_2:1640994_at:339:453; Interrogation_Position=174; Antisense; GATCATTCACTTCAAGCGGCAGCAG
>probe:Drosophila_2:1640994_at:614:81; Interrogation_Position=197; Antisense; AGGGACGTCCCATGCTGGACAGCGA
>probe:Drosophila_2:1640994_at:506:621; Interrogation_Position=209; Antisense; TGCTGGACAGCGACTACGATGGCAC
>probe:Drosophila_2:1640994_at:648:23; Interrogation_Position=28; Antisense; ATATCCTGCTCATTGGTCTGCCTCA
>probe:Drosophila_2:1640994_at:499:129; Interrogation_Position=310; Antisense; ACCTCGTGGAGCCTCGACTTGGGAT
>probe:Drosophila_2:1640994_at:49:103; Interrogation_Position=425; Antisense; AGAGCTACGGCAGCTACGGGAGCAC
>probe:Drosophila_2:1640994_at:359:499; Interrogation_Position=43; Antisense; GTCTGCCTCATCATTCTGGGTAGTG
>probe:Drosophila_2:1640994_at:3:91; Interrogation_Position=469; Antisense; AGTAGTGGCGGCAGCTCCAGTTTCC
>probe:Drosophila_2:1640994_at:475:637; Interrogation_Position=508; Antisense; TCGTCGACGCGGCAAGCAGAGCATC
>probe:Drosophila_2:1640994_at:214:9; Interrogation_Position=55; Antisense; ATTCTGGGTAGTGCCGCCCTTGTGG

Paste this into a BLAST search page for me
ATCAGCGCCATTTTAATCACAGGAGATGCAAAACCTCTCCATATCCTGCTTGATGTATTTACTGGCGGCGCTCTTTCTTCACGCTCATGATCATTCACTTGATCATTCACTTCAAGCGGCAGCAGAGGGACGTCCCATGCTGGACAGCGATGCTGGACAGCGACTACGATGGCACATATCCTGCTCATTGGTCTGCCTCAACCTCGTGGAGCCTCGACTTGGGATAGAGCTACGGCAGCTACGGGAGCACGTCTGCCTCATCATTCTGGGTAGTGAGTAGTGGCGGCAGCTCCAGTTTCCTCGTCGACGCGGCAAGCAGAGCATCATTCTGGGTAGTGCCGCCCTTGTGG

Full Affymetrix probeset data:

Annotations for 1640994_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720