Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640995_at:

>probe:Drosophila_2:1640995_at:617:443; Interrogation_Position=137; Antisense; GATGATCGACCTGACCAAGTTGAGT
>probe:Drosophila_2:1640995_at:696:431; Interrogation_Position=158; Antisense; GAGTCCGGAACAGCTGATTCAGATC
>probe:Drosophila_2:1640995_at:510:461; Interrogation_Position=203; Antisense; GATTACCAACGTACAGGACTCGCTG
>probe:Drosophila_2:1640995_at:543:599; Interrogation_Position=243; Antisense; TGTCAAGCCAAGTACGCCGGATCCA
>probe:Drosophila_2:1640995_at:147:249; Interrogation_Position=266; Antisense; CAAGGAGGCGCTGGGAACCTTTCAA
>probe:Drosophila_2:1640995_at:501:527; Interrogation_Position=298; Antisense; GGGAGAACCGTCAGATCCTGGTGCC
>probe:Drosophila_2:1640995_at:351:505; Interrogation_Position=318; Antisense; GTGCCCCTGACCAGCAGTATGTATG
>probe:Drosophila_2:1640995_at:431:651; Interrogation_Position=355; Antisense; TCAAGGATCTCAACAGGTTCGTCAT
>probe:Drosophila_2:1640995_at:407:539; Interrogation_Position=370; Antisense; GGTTCGTCATAGACATCGGCACCGG
>probe:Drosophila_2:1640995_at:46:641; Interrogation_Position=385; Antisense; TCGGCACCGGCTACTACATTGAAAA
>probe:Drosophila_2:1640995_at:649:211; Interrogation_Position=427; Antisense; AAGACTACTTCAAGCGACGCGTGGA
>probe:Drosophila_2:1640995_at:321:411; Interrogation_Position=500; Antisense; GACGCGCTTCTATAACTCAGTGATG
>probe:Drosophila_2:1640995_at:184:707; Interrogation_Position=592; Antisense; TTACCCAGAGCTCCTAGACTACGGA
>probe:Drosophila_2:1640995_at:97:493; Interrogation_Position=89; Antisense; GTAAGCACTAGCAATGGCTGCCACC

Paste this into a BLAST search page for me
GATGATCGACCTGACCAAGTTGAGTGAGTCCGGAACAGCTGATTCAGATCGATTACCAACGTACAGGACTCGCTGTGTCAAGCCAAGTACGCCGGATCCACAAGGAGGCGCTGGGAACCTTTCAAGGGAGAACCGTCAGATCCTGGTGCCGTGCCCCTGACCAGCAGTATGTATGTCAAGGATCTCAACAGGTTCGTCATGGTTCGTCATAGACATCGGCACCGGTCGGCACCGGCTACTACATTGAAAAAAGACTACTTCAAGCGACGCGTGGAGACGCGCTTCTATAACTCAGTGATGTTACCCAGAGCTCCTAGACTACGGAGTAAGCACTAGCAATGGCTGCCACC

Full Affymetrix probeset data:

Annotations for 1640995_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime