FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640996_at:

>probe:Drosophila_2:1640996_at:479:357; Interrogation_Position=106; Antisense; GCAAATTGCGTGAGACATCCCTATT
>probe:Drosophila_2:1640996_at:133:401; Interrogation_Position=119; Antisense; GACATCCCTATTCAACTGGATCGCA
>probe:Drosophila_2:1640996_at:214:589; Interrogation_Position=135; Antisense; TGGATCGCATTGTGTTCTTGTCGCC
>probe:Drosophila_2:1640996_at:639:713; Interrogation_Position=149; Antisense; TTCTTGTCGCCTGTTGACTTGAATA
>probe:Drosophila_2:1640996_at:167:345; Interrogation_Position=179; Antisense; GCATATTTCAGTTGTCCTTGGCAGA
>probe:Drosophila_2:1640996_at:627:271; Interrogation_Position=195; Antisense; CTTGGCAGAAAGGTAGCTCGCATTC
>probe:Drosophila_2:1640996_at:514:117; Interrogation_Position=209; Antisense; AGCTCGCATTCAACCTGGGCATTAA
>probe:Drosophila_2:1640996_at:389:703; Interrogation_Position=246; Antisense; TTACCTAATAGTCCGGTGAATTGCA
>probe:Drosophila_2:1640996_at:337:547; Interrogation_Position=363; Antisense; GGAGGTTTTATAACATTCCTGAAAT
>probe:Drosophila_2:1640996_at:542:9; Interrogation_Position=377; Antisense; ATTCCTGAAATGCACTTTTCCAAGT
>probe:Drosophila_2:1640996_at:79:221; Interrogation_Position=398; Antisense; AAGTGCATAAATCTGTCGCTACCTC
>probe:Drosophila_2:1640996_at:61:237; Interrogation_Position=407; Antisense; AATCTGTCGCTACCTCCAATTAAGT
>probe:Drosophila_2:1640996_at:226:127; Interrogation_Position=437; Antisense; ACCTCCTCATTAGCTTAGACCAGAT
>probe:Drosophila_2:1640996_at:311:401; Interrogation_Position=51; Antisense; GACAGGCTGTGTTCTAAATTATCAA

Paste this into a BLAST search page for me
GCAAATTGCGTGAGACATCCCTATTGACATCCCTATTCAACTGGATCGCATGGATCGCATTGTGTTCTTGTCGCCTTCTTGTCGCCTGTTGACTTGAATAGCATATTTCAGTTGTCCTTGGCAGACTTGGCAGAAAGGTAGCTCGCATTCAGCTCGCATTCAACCTGGGCATTAATTACCTAATAGTCCGGTGAATTGCAGGAGGTTTTATAACATTCCTGAAATATTCCTGAAATGCACTTTTCCAAGTAAGTGCATAAATCTGTCGCTACCTCAATCTGTCGCTACCTCCAATTAAGTACCTCCTCATTAGCTTAGACCAGATGACAGGCTGTGTTCTAAATTATCAA

Full Affymetrix probeset data:

Annotations for 1640996_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720