FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640997_at:

>probe:Drosophila_2:1640997_at:416:625; Interrogation_Position=4067; Antisense; TGCCGCCAATCATTACTGGTCTCAA
>probe:Drosophila_2:1640997_at:286:591; Interrogation_Position=4083; Antisense; TGGTCTCAATATTCGTACTCCACGC
>probe:Drosophila_2:1640997_at:298:87; Interrogation_Position=4108; Antisense; AGTCCAATGCGGGTGCCGACAAGAA
>probe:Drosophila_2:1640997_at:648:111; Interrogation_Position=4142; Antisense; AGCAACACTATGCAGCCGTGTTCCA
>probe:Drosophila_2:1640997_at:216:307; Interrogation_Position=4180; Antisense; CCTCTGCGTTGTCCCGAAAGGAGTT
>probe:Drosophila_2:1640997_at:258:313; Interrogation_Position=4282; Antisense; GCCAGTTTGGGCTAGTCGAAACCAA
>probe:Drosophila_2:1640997_at:695:593; Interrogation_Position=4312; Antisense; TGCGAGGGCTAACCAAACCCTAAGT
>probe:Drosophila_2:1640997_at:218:13; Interrogation_Position=4341; Antisense; ATTCTTACCTTACCTTCGGATGGAT
>probe:Drosophila_2:1640997_at:114:3; Interrogation_Position=4399; Antisense; ATTGAACGTGAATGTTTCGCTTTTC
>probe:Drosophila_2:1640997_at:15:343; Interrogation_Position=4417; Antisense; GCTTTTCATTTTCCACAACGCATTT
>probe:Drosophila_2:1640997_at:610:199; Interrogation_Position=4433; Antisense; AACGCATTTTCTATATGACAGTGAC
>probe:Drosophila_2:1640997_at:109:231; Interrogation_Position=4468; Antisense; AATGAAACGCGGTCTTTACTCTGGC
>probe:Drosophila_2:1640997_at:214:707; Interrogation_Position=4483; Antisense; TTACTCTGGCACTACGTATCTAGGC
>probe:Drosophila_2:1640997_at:430:483; Interrogation_Position=4498; Antisense; GTATCTAGGCAGTACAACTTGTTTT

Paste this into a BLAST search page for me
TGCCGCCAATCATTACTGGTCTCAATGGTCTCAATATTCGTACTCCACGCAGTCCAATGCGGGTGCCGACAAGAAAGCAACACTATGCAGCCGTGTTCCACCTCTGCGTTGTCCCGAAAGGAGTTGCCAGTTTGGGCTAGTCGAAACCAATGCGAGGGCTAACCAAACCCTAAGTATTCTTACCTTACCTTCGGATGGATATTGAACGTGAATGTTTCGCTTTTCGCTTTTCATTTTCCACAACGCATTTAACGCATTTTCTATATGACAGTGACAATGAAACGCGGTCTTTACTCTGGCTTACTCTGGCACTACGTATCTAGGCGTATCTAGGCAGTACAACTTGTTTT

Full Affymetrix probeset data:

Annotations for 1640997_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720