FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640998_at:

>probe:Drosophila_2:1640998_at:264:671; Interrogation_Position=1008; Antisense; TACGTGCACACGATCGACACTGAGG
>probe:Drosophila_2:1640998_at:553:517; Interrogation_Position=1044; Antisense; GTGGACGACGTGGACTTTTACAATG
>probe:Drosophila_2:1640998_at:398:149; Interrogation_Position=1057; Antisense; ACTTTTACAATGTCGACCGGGAGAG
>probe:Drosophila_2:1640998_at:126:525; Interrogation_Position=1082; Antisense; GGGCAGCGCCTATGAGCGCTACAAG
>probe:Drosophila_2:1640998_at:584:57; Interrogation_Position=1162; Antisense; ATGATGACGACTCCTTTGCGAGCGC
>probe:Drosophila_2:1640998_at:522:191; Interrogation_Position=753; Antisense; AACTACTTAAGTGTGATTCCTGTGG
>probe:Drosophila_2:1640998_at:9:9; Interrogation_Position=768; Antisense; ATTCCTGTGGGCGAGATTGTCCTAG
>probe:Drosophila_2:1640998_at:84:375; Interrogation_Position=792; Antisense; GAAGATTGCTACAACGACCAGGACG
>probe:Drosophila_2:1640998_at:80:551; Interrogation_Position=845; Antisense; GGAGAACTACTTTACCAATGATTAC
>probe:Drosophila_2:1640998_at:358:227; Interrogation_Position=861; Antisense; AATGATTACCCGGACGACGACGAAG
>probe:Drosophila_2:1640998_at:298:387; Interrogation_Position=926; Antisense; GAACAAGTTTATGCTCGATGATGAC
>probe:Drosophila_2:1640998_at:722:137; Interrogation_Position=949; Antisense; ACGAGGATGAGTTTGCCAGCACCAG
>probe:Drosophila_2:1640998_at:153:695; Interrogation_Position=960; Antisense; TTTGCCAGCACCAGCGATGATGATG
>probe:Drosophila_2:1640998_at:575:57; Interrogation_Position=976; Antisense; ATGATGATGACTATGCCACCTTTCG

Paste this into a BLAST search page for me
TACGTGCACACGATCGACACTGAGGGTGGACGACGTGGACTTTTACAATGACTTTTACAATGTCGACCGGGAGAGGGGCAGCGCCTATGAGCGCTACAAGATGATGACGACTCCTTTGCGAGCGCAACTACTTAAGTGTGATTCCTGTGGATTCCTGTGGGCGAGATTGTCCTAGGAAGATTGCTACAACGACCAGGACGGGAGAACTACTTTACCAATGATTACAATGATTACCCGGACGACGACGAAGGAACAAGTTTATGCTCGATGATGACACGAGGATGAGTTTGCCAGCACCAGTTTGCCAGCACCAGCGATGATGATGATGATGATGACTATGCCACCTTTCG

Full Affymetrix probeset data:

Annotations for 1640998_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720