FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640999_at:

>probe:Drosophila_2:1640999_at:161:61; Interrogation_Position=6021; Antisense; ATGTCGGCTAACAATGCAGTTCCCC
>probe:Drosophila_2:1640999_at:69:351; Interrogation_Position=6036; Antisense; GCAGTTCCCCAAAAATCTCAGGTGA
>probe:Drosophila_2:1640999_at:44:569; Interrogation_Position=6101; Antisense; GGCACCATCTATTTCTAGCAGCGAA
>probe:Drosophila_2:1640999_at:438:55; Interrogation_Position=6136; Antisense; ATGAAGACCGCCTCAGGATGCAACG
>probe:Drosophila_2:1640999_at:320:487; Interrogation_Position=6187; Antisense; GTAGCGCCTCCAATCGGAGATCTGG
>probe:Drosophila_2:1640999_at:211:147; Interrogation_Position=6254; Antisense; ACTTAATAGTCATTCCCATCTTTCC
>probe:Drosophila_2:1640999_at:577:271; Interrogation_Position=6270; Antisense; CATCTTTCCCCATTTAGTTCACCAA
>probe:Drosophila_2:1640999_at:284:387; Interrogation_Position=6299; Antisense; GAAAATCCATGCACTGCGATCCGGT
>probe:Drosophila_2:1640999_at:435:449; Interrogation_Position=6316; Antisense; GATCCGGTGGCATTATTTCAGTACT
>probe:Drosophila_2:1640999_at:443:371; Interrogation_Position=6345; Antisense; GAAGGAGTGGGCTCATTTTCGCAGC
>probe:Drosophila_2:1640999_at:672:671; Interrogation_Position=6387; Antisense; TACCCGCATCGGAGTACGCAGCAAG
>probe:Drosophila_2:1640999_at:120:247; Interrogation_Position=6465; Antisense; AATTCCATACTTCATTCGATTCCGC
>probe:Drosophila_2:1640999_at:501:637; Interrogation_Position=6480; Antisense; TCGATTCCGCTGAACTGCAGTGATT
>probe:Drosophila_2:1640999_at:242:485; Interrogation_Position=6525; Antisense; GTATCCATTCTTAACTCATCATTCT

Paste this into a BLAST search page for me
ATGTCGGCTAACAATGCAGTTCCCCGCAGTTCCCCAAAAATCTCAGGTGAGGCACCATCTATTTCTAGCAGCGAAATGAAGACCGCCTCAGGATGCAACGGTAGCGCCTCCAATCGGAGATCTGGACTTAATAGTCATTCCCATCTTTCCCATCTTTCCCCATTTAGTTCACCAAGAAAATCCATGCACTGCGATCCGGTGATCCGGTGGCATTATTTCAGTACTGAAGGAGTGGGCTCATTTTCGCAGCTACCCGCATCGGAGTACGCAGCAAGAATTCCATACTTCATTCGATTCCGCTCGATTCCGCTGAACTGCAGTGATTGTATCCATTCTTAACTCATCATTCT

Full Affymetrix probeset data:

Annotations for 1640999_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720