FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641001_at:

>probe:Drosophila_2:1641001_at:633:57; Interrogation_Position=1070; Antisense; ATGAGTCCTACCTAATTCAGCTCTG
>probe:Drosophila_2:1641001_at:428:155; Interrogation_Position=1130; Antisense; ACAGAGACATCTTCAGCTACGACAA
>probe:Drosophila_2:1641001_at:421:699; Interrogation_Position=1175; Antisense; TTTTCAGTGCCACCAAGCTGGGAAT
>probe:Drosophila_2:1641001_at:265:229; Interrogation_Position=1197; Antisense; AATGACCTGTTCCTGCTTGGTGGAC
>probe:Drosophila_2:1641001_at:512:619; Interrogation_Position=1222; Antisense; TGCTACCTGCTCGACTATTATACTT
>probe:Drosophila_2:1641001_at:17:497; Interrogation_Position=1266; Antisense; GTCAGCCCATAAACTACCCAAGGAT
>probe:Drosophila_2:1641001_at:27:79; Interrogation_Position=1286; Antisense; AGGATCCGCATCAGAAACTCTTCAG
>probe:Drosophila_2:1641001_at:80:83; Interrogation_Position=1329; Antisense; AGTGGAGACCACACCTTTGTATCGC
>probe:Drosophila_2:1641001_at:435:725; Interrogation_Position=1345; Antisense; TTGTATCGCACAAGCCTGGAGTTTA
>probe:Drosophila_2:1641001_at:319:237; Interrogation_Position=1401; Antisense; AATCTTTGGACTTTGCTTGGGTGCT
>probe:Drosophila_2:1641001_at:575:727; Interrogation_Position=1417; Antisense; TTGGGTGCTTCTATGGTCAGTGCCT
>probe:Drosophila_2:1641001_at:367:87; Interrogation_Position=1435; Antisense; AGTGCCTTCGAGTTGATCTACTACC
>probe:Drosophila_2:1641001_at:345:145; Interrogation_Position=1454; Antisense; ACTACCTTACTGTGGGACTTGCTAT
>probe:Drosophila_2:1641001_at:4:605; Interrogation_Position=1622; Antisense; TGAGGCATCCTTTTAACTACAGAAA

Paste this into a BLAST search page for me
ATGAGTCCTACCTAATTCAGCTCTGACAGAGACATCTTCAGCTACGACAATTTTCAGTGCCACCAAGCTGGGAATAATGACCTGTTCCTGCTTGGTGGACTGCTACCTGCTCGACTATTATACTTGTCAGCCCATAAACTACCCAAGGATAGGATCCGCATCAGAAACTCTTCAGAGTGGAGACCACACCTTTGTATCGCTTGTATCGCACAAGCCTGGAGTTTAAATCTTTGGACTTTGCTTGGGTGCTTTGGGTGCTTCTATGGTCAGTGCCTAGTGCCTTCGAGTTGATCTACTACCACTACCTTACTGTGGGACTTGCTATTGAGGCATCCTTTTAACTACAGAAA

Full Affymetrix probeset data:

Annotations for 1641001_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720