FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641003_at:

>probe:Drosophila_2:1641003_at:35:69; Interrogation_Position=172; Antisense; ATGGCCTCCTCTTGCAAATGATACA
>probe:Drosophila_2:1641003_at:585:25; Interrogation_Position=201; Antisense; ATAGAAGACCTTGAGCTGCTGCACT
>probe:Drosophila_2:1641003_at:655:621; Interrogation_Position=217; Antisense; TGCTGCACTCGCAAGTCAACAAGGA
>probe:Drosophila_2:1641003_at:204:501; Interrogation_Position=242; Antisense; GTCGTGTAGAGCTCAATTAGTCCTG
>probe:Drosophila_2:1641003_at:661:381; Interrogation_Position=294; Antisense; GAACGAATTCCAGCAGAGGCCCAAT
>probe:Drosophila_2:1641003_at:290:227; Interrogation_Position=339; Antisense; AAGGCTCTTACTCGCGTCGTAGAGA
>probe:Drosophila_2:1641003_at:421:213; Interrogation_Position=390; Antisense; AAGATGATCCGACTTCCTGTTAACC
>probe:Drosophila_2:1641003_at:657:677; Interrogation_Position=421; Antisense; TAGGATATCTCCTACCCGTAAGGAA
>probe:Drosophila_2:1641003_at:464:21; Interrogation_Position=447; Antisense; ATATTCGGCTGTTTGGTGTCAGACA
>probe:Drosophila_2:1641003_at:322:71; Interrogation_Position=597; Antisense; AGGCAATGTCCTCAGATGTCAAATG
>probe:Drosophila_2:1641003_at:102:341; Interrogation_Position=681; Antisense; GACGGAAAACGTCCTTGGCTTCGAT
>probe:Drosophila_2:1641003_at:485:569; Interrogation_Position=697; Antisense; GGCTTCGATTCGATTTTCGCTCAGC
>probe:Drosophila_2:1641003_at:353:719; Interrogation_Position=712; Antisense; TTCGCTCAGCAAACTTCAACTTCAA
>probe:Drosophila_2:1641003_at:306:633; Interrogation_Position=738; Antisense; TCCGAGTTCGCGTTCGAGTTTTATT

Paste this into a BLAST search page for me
ATGGCCTCCTCTTGCAAATGATACAATAGAAGACCTTGAGCTGCTGCACTTGCTGCACTCGCAAGTCAACAAGGAGTCGTGTAGAGCTCAATTAGTCCTGGAACGAATTCCAGCAGAGGCCCAATAAGGCTCTTACTCGCGTCGTAGAGAAAGATGATCCGACTTCCTGTTAACCTAGGATATCTCCTACCCGTAAGGAAATATTCGGCTGTTTGGTGTCAGACAAGGCAATGTCCTCAGATGTCAAATGGACGGAAAACGTCCTTGGCTTCGATGGCTTCGATTCGATTTTCGCTCAGCTTCGCTCAGCAAACTTCAACTTCAATCCGAGTTCGCGTTCGAGTTTTATT

Full Affymetrix probeset data:

Annotations for 1641003_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720