FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641005_at:

>probe:Drosophila_2:1641005_at:667:107; Interrogation_Position=183; Antisense; AGCACAGCCTCTACCCGTTTACGGA
>probe:Drosophila_2:1641005_at:668:439; Interrogation_Position=244; Antisense; GAGGCGCTCGTGACCAAGAACGTGT
>probe:Drosophila_2:1641005_at:415:383; Interrogation_Position=261; Antisense; GAACGTGTACGTGCATGTGCCGCCA
>probe:Drosophila_2:1641005_at:575:435; Interrogation_Position=286; Antisense; GAGGAGCCAGAGTTCTATCCGGCCT
>probe:Drosophila_2:1641005_at:489:405; Interrogation_Position=324; Antisense; GACGGCCGTTCCCAAGAAGCACTAC
>probe:Drosophila_2:1641005_at:594:305; Interrogation_Position=406; Antisense; CCTCCGGTCCAGGATGAGCACAAGA
>probe:Drosophila_2:1641005_at:366:159; Interrogation_Position=425; Antisense; ACAAGACCCTTGTGTATGTTCTGGT
>probe:Drosophila_2:1641005_at:129:683; Interrogation_Position=439; Antisense; TATGTTCTGGTCAAGAAGCCCGAGG
>probe:Drosophila_2:1641005_at:421:307; Interrogation_Position=589; Antisense; CCATCCGAGGAGTACGGAGCACCAC
>probe:Drosophila_2:1641005_at:591:347; Interrogation_Position=623; Antisense; GCACCGTCGAGCAGTTCTAGTTTGT
>probe:Drosophila_2:1641005_at:16:677; Interrogation_Position=640; Antisense; TAGTTTGTAGTGTCGTCTAGGTCTA
>probe:Drosophila_2:1641005_at:189:497; Interrogation_Position=654; Antisense; GTCTAGGTCTACAGCCCATGAATGT
>probe:Drosophila_2:1641005_at:615:21; Interrogation_Position=681; Antisense; ATATTATTTATGATCGCTGCCATTA
>probe:Drosophila_2:1641005_at:226:449; Interrogation_Position=692; Antisense; GATCGCTGCCATTAAAGAGAGTTTA

Paste this into a BLAST search page for me
AGCACAGCCTCTACCCGTTTACGGAGAGGCGCTCGTGACCAAGAACGTGTGAACGTGTACGTGCATGTGCCGCCAGAGGAGCCAGAGTTCTATCCGGCCTGACGGCCGTTCCCAAGAAGCACTACCCTCCGGTCCAGGATGAGCACAAGAACAAGACCCTTGTGTATGTTCTGGTTATGTTCTGGTCAAGAAGCCCGAGGCCATCCGAGGAGTACGGAGCACCACGCACCGTCGAGCAGTTCTAGTTTGTTAGTTTGTAGTGTCGTCTAGGTCTAGTCTAGGTCTACAGCCCATGAATGTATATTATTTATGATCGCTGCCATTAGATCGCTGCCATTAAAGAGAGTTTA

Full Affymetrix probeset data:

Annotations for 1641005_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720