Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641011_at:

>probe:Drosophila_2:1641011_at:14:257; Interrogation_Position=1223; Antisense; CAAAGTCAGGGTCACAGAGCGCCGA
>probe:Drosophila_2:1641011_at:459:103; Interrogation_Position=1238; Antisense; AGAGCGCCGAGACTTTGCCATCAAG
>probe:Drosophila_2:1641011_at:609:625; Interrogation_Position=1253; Antisense; TGCCATCAAGTCAATCGAGTGGTTG
>probe:Drosophila_2:1641011_at:551:541; Interrogation_Position=1273; Antisense; GGTTGTGTGACCTTCGAAACTACAT
>probe:Drosophila_2:1641011_at:562:389; Interrogation_Position=1288; Antisense; GAAACTACATATTGTACACCCTGTT
>probe:Drosophila_2:1641011_at:413:237; Interrogation_Position=1343; Antisense; AATCTTACTCGAGATGGCAGGCCAA
>probe:Drosophila_2:1641011_at:371:547; Interrogation_Position=1370; Antisense; GGAGGAGATCTTGTGCTGTGACTTT
>probe:Drosophila_2:1641011_at:110:647; Interrogation_Position=1378; Antisense; TCTTGTGCTGTGACTTTGAGGTGCG
>probe:Drosophila_2:1641011_at:616:321; Interrogation_Position=1412; Antisense; GCCCAAGGATGCTTTCGAGCTGTTT
>probe:Drosophila_2:1641011_at:675:693; Interrogation_Position=1424; Antisense; TTTCGAGCTGTTTGCACTGGTCCAG
>probe:Drosophila_2:1641011_at:308:143; Interrogation_Position=1439; Antisense; ACTGGTCCAGGCCAATGCACTGGGA
>probe:Drosophila_2:1641011_at:447:461; Interrogation_Position=1471; Antisense; GATTCATTGCCCAGGTGTCGGAGGA
>probe:Drosophila_2:1641011_at:143:303; Interrogation_Position=1564; Antisense; CCGCCGATTACGTGCAGGCCATCAA
>probe:Drosophila_2:1641011_at:297:563; Interrogation_Position=1622; Antisense; GGAATACACCTACAAGACCTTCGAA

Paste this into a BLAST search page for me
CAAAGTCAGGGTCACAGAGCGCCGAAGAGCGCCGAGACTTTGCCATCAAGTGCCATCAAGTCAATCGAGTGGTTGGGTTGTGTGACCTTCGAAACTACATGAAACTACATATTGTACACCCTGTTAATCTTACTCGAGATGGCAGGCCAAGGAGGAGATCTTGTGCTGTGACTTTTCTTGTGCTGTGACTTTGAGGTGCGGCCCAAGGATGCTTTCGAGCTGTTTTTTCGAGCTGTTTGCACTGGTCCAGACTGGTCCAGGCCAATGCACTGGGAGATTCATTGCCCAGGTGTCGGAGGACCGCCGATTACGTGCAGGCCATCAAGGAATACACCTACAAGACCTTCGAA

Full Affymetrix probeset data:

Annotations for 1641011_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime