FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641012_at:

>probe:Drosophila_2:1641012_at:724:479; Interrogation_Position=295; Antisense; GTTTCGCCGCGTGGCATTGAAGATA
>probe:Drosophila_2:1641012_at:107:39; Interrogation_Position=351; Antisense; ATCGTGTCCGAGAGTCTTTTGTAAG
>probe:Drosophila_2:1641012_at:288:105; Interrogation_Position=380; Antisense; AGAAAGTCCTGCCAGTGGGCCTTCA
>probe:Drosophila_2:1641012_at:237:97; Interrogation_Position=431; Antisense; AGATCTATTGCCCTAGCTGTAACAA
>probe:Drosophila_2:1641012_at:310:25; Interrogation_Position=521; Antisense; ATATGTTCTTTATGCAGCTGCCAAG
>probe:Drosophila_2:1641012_at:436:483; Interrogation_Position=584; Antisense; GTATCTATGGCTTCCAGTTGCACAA
>probe:Drosophila_2:1641012_at:206:431; Interrogation_Position=637; Antisense; GAGTCCCCGCCAATAAAGGTCGAAT
>probe:Drosophila_2:1641012_at:530:223; Interrogation_Position=652; Antisense; AAGGTCGAATCCTCGGTCAGCAAGT
>probe:Drosophila_2:1641012_at:144:195; Interrogation_Position=673; Antisense; AAGTCGCCCTCCTGGCTAAGGAATG
>probe:Drosophila_2:1641012_at:59:599; Interrogation_Position=696; Antisense; TGTCCCGAATTTTTAACTCCACACG
>probe:Drosophila_2:1641012_at:22:177; Interrogation_Position=762; Antisense; AAACAGTTTCCCCAATGCGTTGATA
>probe:Drosophila_2:1641012_at:580:51; Interrogation_Position=776; Antisense; ATGCGTTGATATGGCCAGCGACCAC
>probe:Drosophila_2:1641012_at:418:413; Interrogation_Position=795; Antisense; GACCACTAACACATGGGTGCACTCT
>probe:Drosophila_2:1641012_at:495:581; Interrogation_Position=856; Antisense; TGGCCATATCAAGCAGTCATTCGAA

Paste this into a BLAST search page for me
GTTTCGCCGCGTGGCATTGAAGATAATCGTGTCCGAGAGTCTTTTGTAAGAGAAAGTCCTGCCAGTGGGCCTTCAAGATCTATTGCCCTAGCTGTAACAAATATGTTCTTTATGCAGCTGCCAAGGTATCTATGGCTTCCAGTTGCACAAGAGTCCCCGCCAATAAAGGTCGAATAAGGTCGAATCCTCGGTCAGCAAGTAAGTCGCCCTCCTGGCTAAGGAATGTGTCCCGAATTTTTAACTCCACACGAAACAGTTTCCCCAATGCGTTGATAATGCGTTGATATGGCCAGCGACCACGACCACTAACACATGGGTGCACTCTTGGCCATATCAAGCAGTCATTCGAA

Full Affymetrix probeset data:

Annotations for 1641012_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720