FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641013_at:

>probe:Drosophila_2:1641013_at:239:467; Interrogation_Position=126; Antisense; GTTGACCGTTTTTCATTACTGTCGA
>probe:Drosophila_2:1641013_at:60:465; Interrogation_Position=149; Antisense; GATTGAAGGCCTATTCCAGGACCAA
>probe:Drosophila_2:1641013_at:358:267; Interrogation_Position=165; Antisense; CAGGACCAAGACTAGTTTGCACATA
>probe:Drosophila_2:1641013_at:185:361; Interrogation_Position=193; Antisense; GCAACCTTTTTGCATCCAATCAATA
>probe:Drosophila_2:1641013_at:520:433; Interrogation_Position=246; Antisense; GAGGGCCAATGGTTACAAGCCTTTT
>probe:Drosophila_2:1641013_at:614:201; Interrogation_Position=262; Antisense; AAGCCTTTTCTTTTCGATATCACCG
>probe:Drosophila_2:1641013_at:169:501; Interrogation_Position=286; Antisense; GTCGATGCCTGCCAATTTTTGCGAA
>probe:Drosophila_2:1641013_at:142:247; Interrogation_Position=30; Antisense; AATTCTGGGAGTTTTTGTGGCTGTC
>probe:Drosophila_2:1641013_at:433:31; Interrogation_Position=367; Antisense; ATCAACCATTCTTGCCCGTATGGTA
>probe:Drosophila_2:1641013_at:204:669; Interrogation_Position=390; Antisense; TACGGTGGTACTTAACGATTTTCAT
>probe:Drosophila_2:1641013_at:682:291; Interrogation_Position=405; Antisense; CGATTTTCATCGCATTTCACTACCC
>probe:Drosophila_2:1641013_at:396:275; Interrogation_Position=430; Antisense; CTTCCATTTCCCTCTGGAGATTATT
>probe:Drosophila_2:1641013_at:294:689; Interrogation_Position=451; Antisense; TATTTATCACGCCTAGACTTTCTAA
>probe:Drosophila_2:1641013_at:211:155; Interrogation_Position=68; Antisense; ACAGCGATTCGGCTATGGTTAAAAT

Paste this into a BLAST search page for me
GTTGACCGTTTTTCATTACTGTCGAGATTGAAGGCCTATTCCAGGACCAACAGGACCAAGACTAGTTTGCACATAGCAACCTTTTTGCATCCAATCAATAGAGGGCCAATGGTTACAAGCCTTTTAAGCCTTTTCTTTTCGATATCACCGGTCGATGCCTGCCAATTTTTGCGAAAATTCTGGGAGTTTTTGTGGCTGTCATCAACCATTCTTGCCCGTATGGTATACGGTGGTACTTAACGATTTTCATCGATTTTCATCGCATTTCACTACCCCTTCCATTTCCCTCTGGAGATTATTTATTTATCACGCCTAGACTTTCTAAACAGCGATTCGGCTATGGTTAAAAT

Full Affymetrix probeset data:

Annotations for 1641013_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720