FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641014_at:

>probe:Drosophila_2:1641014_at:601:181; Interrogation_Position=1113; Antisense; AAAACCCTCGAGCTGGGATCGCTAA
>probe:Drosophila_2:1641014_at:532:549; Interrogation_Position=588; Antisense; GGAGGATCAGCCGTATGTGCCCAGA
>probe:Drosophila_2:1641014_at:282:483; Interrogation_Position=600; Antisense; GTATGTGCCCAGATCTCGGGAGATC
>probe:Drosophila_2:1641014_at:369:39; Interrogation_Position=622; Antisense; ATCTCCATGGAGGATCTCACTGACG
>probe:Drosophila_2:1641014_at:275:67; Interrogation_Position=695; Antisense; ATGGCAAGTCTGGTAATTTCGAGCA
>probe:Drosophila_2:1641014_at:45:637; Interrogation_Position=713; Antisense; TCGAGCAGCCAGAAACCAGTGAATT
>probe:Drosophila_2:1641014_at:458:543; Interrogation_Position=756; Antisense; GGATGCTAAGGATCCCCGGGAGTCC
>probe:Drosophila_2:1641014_at:356:651; Interrogation_Position=798; Antisense; TCAAGATGCCCACGATGCCATCGAA
>probe:Drosophila_2:1641014_at:398:167; Interrogation_Position=871; Antisense; AAACGGATTGTCACTCAAACGCCAC
>probe:Drosophila_2:1641014_at:234:201; Interrogation_Position=888; Antisense; AACGCCACAGCGTAAGACGGGTCAT
>probe:Drosophila_2:1641014_at:542:497; Interrogation_Position=908; Antisense; GTCATTCGGGATTCATCGATGGCCA
>probe:Drosophila_2:1641014_at:721:439; Interrogation_Position=925; Antisense; GATGGCCATGGCGAAGAGATTCCCC
>probe:Drosophila_2:1641014_at:560:99; Interrogation_Position=939; Antisense; AGAGATTCCCCAGGAGGACTCCAAG
>probe:Drosophila_2:1641014_at:648:249; Interrogation_Position=960; Antisense; CAAGCAAGAGGTGGCTCCCTATCAC

Paste this into a BLAST search page for me
AAAACCCTCGAGCTGGGATCGCTAAGGAGGATCAGCCGTATGTGCCCAGAGTATGTGCCCAGATCTCGGGAGATCATCTCCATGGAGGATCTCACTGACGATGGCAAGTCTGGTAATTTCGAGCATCGAGCAGCCAGAAACCAGTGAATTGGATGCTAAGGATCCCCGGGAGTCCTCAAGATGCCCACGATGCCATCGAAAAACGGATTGTCACTCAAACGCCACAACGCCACAGCGTAAGACGGGTCATGTCATTCGGGATTCATCGATGGCCAGATGGCCATGGCGAAGAGATTCCCCAGAGATTCCCCAGGAGGACTCCAAGCAAGCAAGAGGTGGCTCCCTATCAC

Full Affymetrix probeset data:

Annotations for 1641014_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720