FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641017_at:

>probe:Drosophila_2:1641017_at:427:199; Interrogation_Position=293; Antisense; AACGACATTGTAGTGGGCGCCGTCT
>probe:Drosophila_2:1641017_at:550:501; Interrogation_Position=321; Antisense; GTCGCATCGACAACACTGAGAACCA
>probe:Drosophila_2:1641017_at:170:203; Interrogation_Position=341; Antisense; AACCAGCGGCGCCTGTATATCATGA
>probe:Drosophila_2:1641017_at:340:687; Interrogation_Position=356; Antisense; TATATCATGACCCTAGGATGCCTCT
>probe:Drosophila_2:1641017_at:717:285; Interrogation_Position=395; Antisense; CTGGGCATCGGCACAGTTATGTTCG
>probe:Drosophila_2:1641017_at:395:421; Interrogation_Position=419; Antisense; GAGCACATTATGAACTTCGCCGAGA
>probe:Drosophila_2:1641017_at:326:557; Interrogation_Position=445; Antisense; GGACGGAAACTTCGACAGCATTTTT
>probe:Drosophila_2:1641017_at:513:159; Interrogation_Position=489; Antisense; ACAACGGAGCCATCGAGTTCTATAA
>probe:Drosophila_2:1641017_at:98:289; Interrogation_Position=570; Antisense; CGGCGGACGCTCATGTACTGCAAAA
>probe:Drosophila_2:1641017_at:489:489; Interrogation_Position=584; Antisense; GTACTGCAAAAGACTCTGCGCCGCA
>probe:Drosophila_2:1641017_at:157:209; Interrogation_Position=669; Antisense; AAGCACGACAGTTCACATTTGTTTA
>probe:Drosophila_2:1641017_at:477:179; Interrogation_Position=718; Antisense; AAACAGACATGTAGAGGCGGCCAAA
>probe:Drosophila_2:1641017_at:588:573; Interrogation_Position=733; Antisense; GGCGGCCAAAACGATGTATTCAATT
>probe:Drosophila_2:1641017_at:636:653; Interrogation_Position=781; Antisense; TCAATAATAATTACCCCTGCGCGGG

Paste this into a BLAST search page for me
AACGACATTGTAGTGGGCGCCGTCTGTCGCATCGACAACACTGAGAACCAAACCAGCGGCGCCTGTATATCATGATATATCATGACCCTAGGATGCCTCTCTGGGCATCGGCACAGTTATGTTCGGAGCACATTATGAACTTCGCCGAGAGGACGGAAACTTCGACAGCATTTTTACAACGGAGCCATCGAGTTCTATAACGGCGGACGCTCATGTACTGCAAAAGTACTGCAAAAGACTCTGCGCCGCAAAGCACGACAGTTCACATTTGTTTAAAACAGACATGTAGAGGCGGCCAAAGGCGGCCAAAACGATGTATTCAATTTCAATAATAATTACCCCTGCGCGGG

Full Affymetrix probeset data:

Annotations for 1641017_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720