FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641023_at:

>probe:Drosophila_2:1641023_at:349:375; Interrogation_Position=6011; Antisense; GAAGATCAATTGAAGTAGCCCAATG
>probe:Drosophila_2:1641023_at:656:527; Interrogation_Position=6036; Antisense; GGGACGCACTGCCTACTCTTACATC
>probe:Drosophila_2:1641023_at:391:669; Interrogation_Position=6049; Antisense; TACTCTTACATCTCGTTTACTGGCC
>probe:Drosophila_2:1641023_at:696:151; Interrogation_Position=6129; Antisense; ACATGTAGCTACGTAGATTAAGGCA
>probe:Drosophila_2:1641023_at:65:403; Interrogation_Position=6144; Antisense; GATTAAGGCAATCCGTACTATAGGA
>probe:Drosophila_2:1641023_at:267:475; Interrogation_Position=6216; Antisense; GTTACTTTTACGATCACCACTTATG
>probe:Drosophila_2:1641023_at:90:455; Interrogation_Position=6227; Antisense; GATCACCACTTATGCATAGTTATTT
>probe:Drosophila_2:1641023_at:10:175; Interrogation_Position=6263; Antisense; CATAACCGTAAGCAGGAAACCAACA
>probe:Drosophila_2:1641023_at:280:17; Interrogation_Position=6318; Antisense; ATTTTCTTATGTAGCGTGTACCAAC
>probe:Drosophila_2:1641023_at:72:257; Interrogation_Position=6368; Antisense; CAAATTGGATAATTGCCTTGAAGCA
>probe:Drosophila_2:1641023_at:457:253; Interrogation_Position=6401; Antisense; CAACCACAAACCACCGCAATTTATT
>probe:Drosophila_2:1641023_at:661:103; Interrogation_Position=6451; Antisense; AGACCCAGTGGCAGGCGAAAGCAAA
>probe:Drosophila_2:1641023_at:372:111; Interrogation_Position=6526; Antisense; AGCAAGAAGCATACCGTGAATCGTT
>probe:Drosophila_2:1641023_at:662:289; Interrogation_Position=6540; Antisense; CGTGAATCGTTCACAATCACTTTAA

Paste this into a BLAST search page for me
GAAGATCAATTGAAGTAGCCCAATGGGGACGCACTGCCTACTCTTACATCTACTCTTACATCTCGTTTACTGGCCACATGTAGCTACGTAGATTAAGGCAGATTAAGGCAATCCGTACTATAGGAGTTACTTTTACGATCACCACTTATGGATCACCACTTATGCATAGTTATTTCATAACCGTAAGCAGGAAACCAACAATTTTCTTATGTAGCGTGTACCAACCAAATTGGATAATTGCCTTGAAGCACAACCACAAACCACCGCAATTTATTAGACCCAGTGGCAGGCGAAAGCAAAAGCAAGAAGCATACCGTGAATCGTTCGTGAATCGTTCACAATCACTTTAA

Full Affymetrix probeset data:

Annotations for 1641023_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720