Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641024_at:

>probe:Drosophila_2:1641024_at:192:429; Interrogation_Position=4074; Antisense; GAGTTGCATGCCACAGTGACCGAAT
>probe:Drosophila_2:1641024_at:85:451; Interrogation_Position=4145; Antisense; GATCGCCGATCCAAGCAATCAATGT
>probe:Drosophila_2:1641024_at:39:219; Interrogation_Position=4182; Antisense; AAGTACTTGCACCACATGTCGGAAA
>probe:Drosophila_2:1641024_at:448:659; Interrogation_Position=4211; Antisense; TAAGCAGGTGAAGCCGAACGCCCAG
>probe:Drosophila_2:1641024_at:569:187; Interrogation_Position=4290; Antisense; AACACTCAGGAAGTTAGCCCGCAGG
>probe:Drosophila_2:1641024_at:114:551; Interrogation_Position=4313; Antisense; GGAGTTCCTGCCTGAGATCAATTTG
>probe:Drosophila_2:1641024_at:712:453; Interrogation_Position=4328; Antisense; GATCAATTTGTCCACTTGCAGTCCG
>probe:Drosophila_2:1641024_at:702:347; Interrogation_Position=4345; Antisense; GCAGTCCGGATCTCGTGGTGAAGAA
>probe:Drosophila_2:1641024_at:590:587; Interrogation_Position=4360; Antisense; TGGTGAAGAATTGGGCCTACGCCGT
>probe:Drosophila_2:1641024_at:377:497; Interrogation_Position=4405; Antisense; GTCAGGATACACTGCTCGGCAAGAT
>probe:Drosophila_2:1641024_at:235:351; Interrogation_Position=4433; Antisense; GCAGCTGTTCTCTAAATACGCCAAG
>probe:Drosophila_2:1641024_at:548:675; Interrogation_Position=4476; Antisense; TAGCTCTCGAAACTTTTGGCACACG
>probe:Drosophila_2:1641024_at:173:599; Interrogation_Position=4523; Antisense; TGTAAGAACTTTCGCCGTACCATTG
>probe:Drosophila_2:1641024_at:111:725; Interrogation_Position=4545; Antisense; TTGACACCCTTCATTGCCACAGAAT

Paste this into a BLAST search page for me
GAGTTGCATGCCACAGTGACCGAATGATCGCCGATCCAAGCAATCAATGTAAGTACTTGCACCACATGTCGGAAATAAGCAGGTGAAGCCGAACGCCCAGAACACTCAGGAAGTTAGCCCGCAGGGGAGTTCCTGCCTGAGATCAATTTGGATCAATTTGTCCACTTGCAGTCCGGCAGTCCGGATCTCGTGGTGAAGAATGGTGAAGAATTGGGCCTACGCCGTGTCAGGATACACTGCTCGGCAAGATGCAGCTGTTCTCTAAATACGCCAAGTAGCTCTCGAAACTTTTGGCACACGTGTAAGAACTTTCGCCGTACCATTGTTGACACCCTTCATTGCCACAGAAT

Full Affymetrix probeset data:

Annotations for 1641024_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime