FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641025_at:

>probe:Drosophila_2:1641025_at:133:225; Interrogation_Position=329; Antisense; AAGGATCTGCAACTGCCGCCTGAGA
>probe:Drosophila_2:1641025_at:376:625; Interrogation_Position=342; Antisense; TGCCGCCTGAGATCAAGGGCCTGAA
>probe:Drosophila_2:1641025_at:681:249; Interrogation_Position=374; Antisense; CAATGTACGCCGCTCTTTATGCTGG
>probe:Drosophila_2:1641025_at:439:525; Interrogation_Position=468; Antisense; TGTGGCCAGGGAAAACCTTCCGCTG
>probe:Drosophila_2:1641025_at:419:335; Interrogation_Position=489; Antisense; GCTGCACCCACTTGGAGATGATCAA
>probe:Drosophila_2:1641025_at:580:75; Interrogation_Position=558; Antisense; AGGAGCTCGTCGTACCGATCATCGA
>probe:Drosophila_2:1641025_at:410:449; Interrogation_Position=574; Antisense; GATCATCGAGAACACACCCTTTGAA
>probe:Drosophila_2:1641025_at:85:295; Interrogation_Position=610; Antisense; CGACAGTATGTACGCCGCCATGATG
>probe:Drosophila_2:1641025_at:156:431; Interrogation_Position=635; Antisense; GAGTATCCGGGCTGCAGTGCGATCC
>probe:Drosophila_2:1641025_at:620:85; Interrogation_Position=650; Antisense; AGTGCGATCCTGGTTCGACGACACG
>probe:Drosophila_2:1641025_at:114:565; Interrogation_Position=721; Antisense; GGAATGCTATGACTATCTCTTCTCC
>probe:Drosophila_2:1641025_at:687:685; Interrogation_Position=734; Antisense; TATCTCTTCTCCATTGCCGTGGAAA
>probe:Drosophila_2:1641025_at:1:379; Interrogation_Position=809; Antisense; GAAGCTGATACGAACGCACATTCTA
>probe:Drosophila_2:1641025_at:712:355; Interrogation_Position=824; Antisense; GCACATTCTACTTGTCGTTTAACCC

Paste this into a BLAST search page for me
AAGGATCTGCAACTGCCGCCTGAGATGCCGCCTGAGATCAAGGGCCTGAACAATGTACGCCGCTCTTTATGCTGGTGTGGCCAGGGAAAACCTTCCGCTGGCTGCACCCACTTGGAGATGATCAAAGGAGCTCGTCGTACCGATCATCGAGATCATCGAGAACACACCCTTTGAACGACAGTATGTACGCCGCCATGATGGAGTATCCGGGCTGCAGTGCGATCCAGTGCGATCCTGGTTCGACGACACGGGAATGCTATGACTATCTCTTCTCCTATCTCTTCTCCATTGCCGTGGAAAGAAGCTGATACGAACGCACATTCTAGCACATTCTACTTGTCGTTTAACCC

Full Affymetrix probeset data:

Annotations for 1641025_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720