Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641027_at:

>probe:Drosophila_2:1641027_at:59:251; Interrogation_Position=2597; Antisense; CAACATTGGGCTGTTTGGGCCCTGG
>probe:Drosophila_2:1641027_at:641:39; Interrogation_Position=2625; Antisense; ATCTGACACAGGTTTATCCCGAAAA
>probe:Drosophila_2:1641027_at:206:75; Interrogation_Position=2670; Antisense; AGGAGAACGGCATCCAGATCCTCAA
>probe:Drosophila_2:1641027_at:554:409; Interrogation_Position=2696; Antisense; GAGCTAATCGAGCACGAGAGTCCCT
>probe:Drosophila_2:1641027_at:20:427; Interrogation_Position=2711; Antisense; GAGAGTCCCTACTGCGAGATCAAGC
>probe:Drosophila_2:1641027_at:268:45; Interrogation_Position=2738; Antisense; ATCGCTCGCCTGGTCATAGAGCAGT
>probe:Drosophila_2:1641027_at:572:677; Interrogation_Position=2754; Antisense; TAGAGCAGTGCGACTCCGGATCGGA
>probe:Drosophila_2:1641027_at:556:41; Interrogation_Position=2773; Antisense; ATCGGAACGCATGGTCGTCGACGGC
>probe:Drosophila_2:1641027_at:457:501; Interrogation_Position=2786; Antisense; GTCGTCGACGGCTAAGCGGATATTT
>probe:Drosophila_2:1641027_at:685:659; Interrogation_Position=2815; Antisense; TAACACGTAGCTTTAGGAGTCGAGT
>probe:Drosophila_2:1641027_at:477:477; Interrogation_Position=2870; Antisense; GTTTCCCGTTTTAAAGCAAGTGCAT
>probe:Drosophila_2:1641027_at:579:101; Interrogation_Position=2910; Antisense; AGAGATTCTTCCTTGACTTTTATGT
>probe:Drosophila_2:1641027_at:470:651; Interrogation_Position=3060; Antisense; TCACATGTTGTAAGCCAGCGATCTT
>probe:Drosophila_2:1641027_at:533:261; Interrogation_Position=3075; Antisense; CAGCGATCTTTTTAGGCCTTCAGAA

Paste this into a BLAST search page for me
CAACATTGGGCTGTTTGGGCCCTGGATCTGACACAGGTTTATCCCGAAAAAGGAGAACGGCATCCAGATCCTCAAGAGCTAATCGAGCACGAGAGTCCCTGAGAGTCCCTACTGCGAGATCAAGCATCGCTCGCCTGGTCATAGAGCAGTTAGAGCAGTGCGACTCCGGATCGGAATCGGAACGCATGGTCGTCGACGGCGTCGTCGACGGCTAAGCGGATATTTTAACACGTAGCTTTAGGAGTCGAGTGTTTCCCGTTTTAAAGCAAGTGCATAGAGATTCTTCCTTGACTTTTATGTTCACATGTTGTAAGCCAGCGATCTTCAGCGATCTTTTTAGGCCTTCAGAA

Full Affymetrix probeset data:

Annotations for 1641027_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime