Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641028_at:

>probe:Drosophila_2:1641028_at:488:119; Interrogation_Position=1283; Antisense; AGCTGCTGGTTTGGCTGAGCGCCCT
>probe:Drosophila_2:1641028_at:207:641; Interrogation_Position=1310; Antisense; TCGGCCTGCTCAGCAGCTGTGGAGC
>probe:Drosophila_2:1641028_at:71:207; Interrogation_Position=1400; Antisense; AAGCGGTCGCCTGCGAGGCCAACTG
>probe:Drosophila_2:1641028_at:334:325; Interrogation_Position=1412; Antisense; GCGAGGCCAACTGCCACGAGCAGGA
>probe:Drosophila_2:1641028_at:271:315; Interrogation_Position=1522; Antisense; GCCTTCAGGACGTGGCTGTGGTCCA
>probe:Drosophila_2:1641028_at:185:595; Interrogation_Position=1538; Antisense; TGTGGTCCAGCTCTTGGCATGCCTA
>probe:Drosophila_2:1641028_at:598:569; Interrogation_Position=1553; Antisense; GGCATGCCTACAAGCTGACCTGCAG
>probe:Drosophila_2:1641028_at:663:607; Interrogation_Position=1568; Antisense; TGACCTGCAGCAAAATACGATACTT
>probe:Drosophila_2:1641028_at:100:255; Interrogation_Position=1578; Antisense; CAAAATACGATACTTCAGCAGCCGG
>probe:Drosophila_2:1641028_at:499:409; Interrogation_Position=1620; Antisense; GACGAGGGCCGCTCGTTCAGCGAAC
>probe:Drosophila_2:1641028_at:358:711; Interrogation_Position=1635; Antisense; TTCAGCGAACTCCAAGGACCCAAGT
>probe:Drosophila_2:1641028_at:147:351; Interrogation_Position=1688; Antisense; GCACTAGGACTAGGAACTACCGCTT
>probe:Drosophila_2:1641028_at:659:559; Interrogation_Position=1700; Antisense; GGAACTACCGCTTCTTCTACTACTA
>probe:Drosophila_2:1641028_at:284:189; Interrogation_Position=1732; Antisense; AACATCAACGACTGGTGGCGGAGAT

Paste this into a BLAST search page for me
AGCTGCTGGTTTGGCTGAGCGCCCTTCGGCCTGCTCAGCAGCTGTGGAGCAAGCGGTCGCCTGCGAGGCCAACTGGCGAGGCCAACTGCCACGAGCAGGAGCCTTCAGGACGTGGCTGTGGTCCATGTGGTCCAGCTCTTGGCATGCCTAGGCATGCCTACAAGCTGACCTGCAGTGACCTGCAGCAAAATACGATACTTCAAAATACGATACTTCAGCAGCCGGGACGAGGGCCGCTCGTTCAGCGAACTTCAGCGAACTCCAAGGACCCAAGTGCACTAGGACTAGGAACTACCGCTTGGAACTACCGCTTCTTCTACTACTAAACATCAACGACTGGTGGCGGAGAT

Full Affymetrix probeset data:

Annotations for 1641028_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime