FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641030_at:

>probe:Drosophila_2:1641030_at:688:599; Interrogation_Position=130; Antisense; TGTAACACATCGAGGGCTGGCTGCT
>probe:Drosophila_2:1641030_at:339:333; Interrogation_Position=145; Antisense; GCTGGCTGCTGTTCTGAACTTTATA
>probe:Drosophila_2:1641030_at:638:435; Interrogation_Position=181; Antisense; GAGGACCTGGTCAAGTGCTTCGTTA
>probe:Drosophila_2:1641030_at:646:713; Interrogation_Position=199; Antisense; TTCGTTATACACTCACCCAAGTTGC
>probe:Drosophila_2:1641030_at:101:529; Interrogation_Position=233; Antisense; GGGACGCTGACATCGGCAAGACACT
>probe:Drosophila_2:1641030_at:428:397; Interrogation_Position=252; Antisense; GACACTGAGGTTTCTATCGTGCTTT
>probe:Drosophila_2:1641030_at:170:43; Interrogation_Position=267; Antisense; ATCGTGCTTTGTGGAGTGCCTGTAC
>probe:Drosophila_2:1641030_at:505:211; Interrogation_Position=358; Antisense; AAGACATTTGTGGATCGGCCCAAGG
>probe:Drosophila_2:1641030_at:141:151; Interrogation_Position=395; Antisense; ACATTGCCATGTTCGAGTTCTGTCG
>probe:Drosophila_2:1641030_at:414:597; Interrogation_Position=490; Antisense; TGTCGCCCCTATCTATTGATGGTAT
>probe:Drosophila_2:1641030_at:57:35; Interrogation_Position=536; Antisense; ATCAGAAGCACGAGTGTCCCTACTT
>probe:Drosophila_2:1641030_at:473:147; Interrogation_Position=557; Antisense; ACTTCCGGTGGGAGGGCACTGCCAA
>probe:Drosophila_2:1641030_at:280:13; Interrogation_Position=640; Antisense; ATTACACTGCCCACAAAGAGTCCTG
>probe:Drosophila_2:1641030_at:529:469; Interrogation_Position=94; Antisense; GTTGCCATATCTTCAGGTGACTTGA

Paste this into a BLAST search page for me
TGTAACACATCGAGGGCTGGCTGCTGCTGGCTGCTGTTCTGAACTTTATAGAGGACCTGGTCAAGTGCTTCGTTATTCGTTATACACTCACCCAAGTTGCGGGACGCTGACATCGGCAAGACACTGACACTGAGGTTTCTATCGTGCTTTATCGTGCTTTGTGGAGTGCCTGTACAAGACATTTGTGGATCGGCCCAAGGACATTGCCATGTTCGAGTTCTGTCGTGTCGCCCCTATCTATTGATGGTATATCAGAAGCACGAGTGTCCCTACTTACTTCCGGTGGGAGGGCACTGCCAAATTACACTGCCCACAAAGAGTCCTGGTTGCCATATCTTCAGGTGACTTGA

Full Affymetrix probeset data:

Annotations for 1641030_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720