Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641032_at:

>probe:Drosophila_2:1641032_at:234:97; Interrogation_Position=1752; Antisense; AGATCCCAGAAGTCAGTTCTCCAAG
>probe:Drosophila_2:1641032_at:418:281; Interrogation_Position=1770; Antisense; CTCCAAGCCCAATTCTTCGGAAATA
>probe:Drosophila_2:1641032_at:360:243; Interrogation_Position=1791; Antisense; AATATGTTTCACACATTCCGGCTCC
>probe:Drosophila_2:1641032_at:335:569; Interrogation_Position=1810; Antisense; GGCTCCATAACTCCGACCAGTAATG
>probe:Drosophila_2:1641032_at:627:223; Interrogation_Position=1888; Antisense; AAGGACCGAGCGAAGTTCTCCAAGT
>probe:Drosophila_2:1641032_at:548:433; Interrogation_Position=1924; Antisense; GAGGGCGACGCTACTGACCCTGAAT
>probe:Drosophila_2:1641032_at:642:163; Interrogation_Position=1975; Antisense; AAATCTGCTGTGGACCTGGAGCCGC
>probe:Drosophila_2:1641032_at:57:555; Interrogation_Position=1992; Antisense; GGAGCCGCATAATGTCAACCAGCAG
>probe:Drosophila_2:1641032_at:452:109; Interrogation_Position=2051; Antisense; AGAAGGAGCGCACCCTAGACGATGA
>probe:Drosophila_2:1641032_at:82:677; Interrogation_Position=2066; Antisense; TAGACGATGACCTGCGCGACATGAG
>probe:Drosophila_2:1641032_at:331:417; Interrogation_Position=2088; Antisense; GAGCGCCTACCAAAAGGTCATGCAT
>probe:Drosophila_2:1641032_at:217:527; Interrogation_Position=2157; Antisense; GGGCAAGTTCATCGACTCGCATGCG
>probe:Drosophila_2:1641032_at:460:289; Interrogation_Position=2191; Antisense; CGGGTTAGCCGCTTCAAGGAGCAGC
>probe:Drosophila_2:1641032_at:239:421; Interrogation_Position=2209; Antisense; GAGCAGCGAGCCCTTAACAAAACGT

Paste this into a BLAST search page for me
AGATCCCAGAAGTCAGTTCTCCAAGCTCCAAGCCCAATTCTTCGGAAATAAATATGTTTCACACATTCCGGCTCCGGCTCCATAACTCCGACCAGTAATGAAGGACCGAGCGAAGTTCTCCAAGTGAGGGCGACGCTACTGACCCTGAATAAATCTGCTGTGGACCTGGAGCCGCGGAGCCGCATAATGTCAACCAGCAGAGAAGGAGCGCACCCTAGACGATGATAGACGATGACCTGCGCGACATGAGGAGCGCCTACCAAAAGGTCATGCATGGGCAAGTTCATCGACTCGCATGCGCGGGTTAGCCGCTTCAAGGAGCAGCGAGCAGCGAGCCCTTAACAAAACGT

Full Affymetrix probeset data:

Annotations for 1641032_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime