FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641034_at:

>probe:Drosophila_2:1641034_at:106:363; Interrogation_Position=542; Antisense; GCAATCATCAGTGCCGGTTCCTTAT
>probe:Drosophila_2:1641034_at:718:31; Interrogation_Position=548; Antisense; ATCAGTGCCGGTTCCTTATACTCAA
>probe:Drosophila_2:1641034_at:474:85; Interrogation_Position=551; Antisense; AGTGCCGGTTCCTTATACTCAAGGC
>probe:Drosophila_2:1641034_at:410:303; Interrogation_Position=554; Antisense; GCCGGTTCCTTATACTCAAGGCAAT
>probe:Drosophila_2:1641034_at:170:541; Interrogation_Position=557; Antisense; GGTTCCTTATACTCAAGGCAATCTG
>probe:Drosophila_2:1641034_at:99:687; Interrogation_Position=564; Antisense; TATACTCAAGGCAATCTGGCACAAA
>probe:Drosophila_2:1641034_at:65:281; Interrogation_Position=568; Antisense; CTCAAGGCAATCTGGCACAAAAATA
>probe:Drosophila_2:1641034_at:323:71; Interrogation_Position=572; Antisense; AGGCAATCTGGCACAAAAATATGGA
>probe:Drosophila_2:1641034_at:417:255; Interrogation_Position=585; Antisense; CAAAAATATGGATCACTGCGGGTTT
>probe:Drosophila_2:1641034_at:591:23; Interrogation_Position=590; Antisense; ATATGGATCACTGCGGGTTTTTGTA
>probe:Drosophila_2:1641034_at:205:455; Interrogation_Position=595; Antisense; GATCACTGCGGGTTTTTGTACGAAA
>probe:Drosophila_2:1641034_at:192:633; Interrogation_Position=626; Antisense; TCCGTCTTTATAAACCCAATAGAAG
>probe:Drosophila_2:1641034_at:373:151; Interrogation_Position=77; Antisense; ACATCATCTGCGAGCTGCTCCTGCG
>probe:Drosophila_2:1641034_at:355:39; Interrogation_Position=82; Antisense; ATCTGCGAGCTGCTCCTGCGTTTCG

Paste this into a BLAST search page for me
GCAATCATCAGTGCCGGTTCCTTATATCAGTGCCGGTTCCTTATACTCAAAGTGCCGGTTCCTTATACTCAAGGCGCCGGTTCCTTATACTCAAGGCAATGGTTCCTTATACTCAAGGCAATCTGTATACTCAAGGCAATCTGGCACAAACTCAAGGCAATCTGGCACAAAAATAAGGCAATCTGGCACAAAAATATGGACAAAAATATGGATCACTGCGGGTTTATATGGATCACTGCGGGTTTTTGTAGATCACTGCGGGTTTTTGTACGAAATCCGTCTTTATAAACCCAATAGAAGACATCATCTGCGAGCTGCTCCTGCGATCTGCGAGCTGCTCCTGCGTTTCG

Full Affymetrix probeset data:

Annotations for 1641034_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720