FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641036_at:

>probe:Drosophila_2:1641036_at:94:55; Interrogation_Position=455; Antisense; ATGACTTTTCGCTGGAGCAGATCAA
>probe:Drosophila_2:1641036_at:199:595; Interrogation_Position=497; Antisense; TGGGCATCTATTGCTCGCAGTGTAC
>probe:Drosophila_2:1641036_at:702:117; Interrogation_Position=530; Antisense; AGCTGGTGGAGTTCAAGGCCGCCAA
>probe:Drosophila_2:1641036_at:683:627; Interrogation_Position=560; Antisense; TGCCATCCGATGTCAAGGCCAGTGG
>probe:Drosophila_2:1641036_at:579:363; Interrogation_Position=645; Antisense; GAATAGCTATGTGCCGATCGAGAGT
>probe:Drosophila_2:1641036_at:602:425; Interrogation_Position=664; Antisense; GAGAGTTTGGCCAAGGGTGCCCTCA
>probe:Drosophila_2:1641036_at:386:343; Interrogation_Position=689; Antisense; GCTTCCACGTGTATCACAAGTGCTT
>probe:Drosophila_2:1641036_at:51:81; Interrogation_Position=725; Antisense; AGGGTATCTGCACGCCGGACATGTA
>probe:Drosophila_2:1641036_at:240:57; Interrogation_Position=745; Antisense; ATGTACTCCTATCAGAAACCGACCT
>probe:Drosophila_2:1641036_at:665:173; Interrogation_Position=760; Antisense; AAACCGACCTGCATCAAGTGCCTGG
>probe:Drosophila_2:1641036_at:609:589; Interrogation_Position=796; Antisense; TGGTTCTCGCCGCAGAAATTCGTGG
>probe:Drosophila_2:1641036_at:407:163; Interrogation_Position=811; Antisense; AAATTCGTGGGTCATGTGCATCGCA
>probe:Drosophila_2:1641036_at:147:217; Interrogation_Position=835; Antisense; AAGTTCGAGAATCACACCTGCCACT
>probe:Drosophila_2:1641036_at:682:359; Interrogation_Position=875; Antisense; GCAACTGGCACGACTATCTTCATGT

Paste this into a BLAST search page for me
ATGACTTTTCGCTGGAGCAGATCAATGGGCATCTATTGCTCGCAGTGTACAGCTGGTGGAGTTCAAGGCCGCCAATGCCATCCGATGTCAAGGCCAGTGGGAATAGCTATGTGCCGATCGAGAGTGAGAGTTTGGCCAAGGGTGCCCTCAGCTTCCACGTGTATCACAAGTGCTTAGGGTATCTGCACGCCGGACATGTAATGTACTCCTATCAGAAACCGACCTAAACCGACCTGCATCAAGTGCCTGGTGGTTCTCGCCGCAGAAATTCGTGGAAATTCGTGGGTCATGTGCATCGCAAAGTTCGAGAATCACACCTGCCACTGCAACTGGCACGACTATCTTCATGT

Full Affymetrix probeset data:

Annotations for 1641036_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720