Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641037_at:

>probe:Drosophila_2:1641037_at:286:361; Interrogation_Position=10692; Antisense; GCAAGAGCCTGTTCAGCAATGCGAA
>probe:Drosophila_2:1641037_at:159:55; Interrogation_Position=10733; Antisense; ATGAAGACTGGCTCGTACTTGACCT
>probe:Drosophila_2:1641037_at:186:589; Interrogation_Position=10761; Antisense; TGGATCTCACCTATTTGGCCAGTCC
>probe:Drosophila_2:1641037_at:47:505; Interrogation_Position=10797; Antisense; GTCCTGGTTGCGGTGGTCAATTCTA
>probe:Drosophila_2:1641037_at:417:493; Interrogation_Position=10812; Antisense; GTCAATTCTACAATACCGAGGGCAT
>probe:Drosophila_2:1641037_at:540:525; Interrogation_Position=10831; Antisense; GGGCATATTCTCAAATCCCTTCTAT
>probe:Drosophila_2:1641037_at:684:233; Interrogation_Position=10844; Antisense; AATCCCTTCTATCCGAACAATGTGC
>probe:Drosophila_2:1641037_at:220:543; Interrogation_Position=10890; Antisense; GGATTGTCCGCGTGCCGAGCAACAA
>probe:Drosophila_2:1641037_at:288:723; Interrogation_Position=10932; Antisense; TTGAAGTCTTCAATCTGGGCTCGAA
>probe:Drosophila_2:1641037_at:238:141; Interrogation_Position=10970; Antisense; ACGGACTACCTGCAAATCCTGGAAC
>probe:Drosophila_2:1641037_at:431:171; Interrogation_Position=11050; Antisense; AAAGTACTACAAGAGCCGGCGCAGC
>probe:Drosophila_2:1641037_at:307:265; Interrogation_Position=11167; Antisense; CAGACACCTGTTGGGCGGTTCTTAA
>probe:Drosophila_2:1641037_at:392:473; Interrogation_Position=11184; Antisense; GTTCTTAACCGCTTGATTTCTTCTT
>probe:Drosophila_2:1641037_at:433:17; Interrogation_Position=11199; Antisense; ATTTCTTCTTCAGCCGCAATCTGTA

Paste this into a BLAST search page for me
GCAAGAGCCTGTTCAGCAATGCGAAATGAAGACTGGCTCGTACTTGACCTTGGATCTCACCTATTTGGCCAGTCCGTCCTGGTTGCGGTGGTCAATTCTAGTCAATTCTACAATACCGAGGGCATGGGCATATTCTCAAATCCCTTCTATAATCCCTTCTATCCGAACAATGTGCGGATTGTCCGCGTGCCGAGCAACAATTGAAGTCTTCAATCTGGGCTCGAAACGGACTACCTGCAAATCCTGGAACAAAGTACTACAAGAGCCGGCGCAGCCAGACACCTGTTGGGCGGTTCTTAAGTTCTTAACCGCTTGATTTCTTCTTATTTCTTCTTCAGCCGCAATCTGTA

Full Affymetrix probeset data:

Annotations for 1641037_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime