FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641038_at:

>probe:Drosophila_2:1641038_at:93:169; Interrogation_Position=1018; Antisense; AAATGGCTGCAATGTGGCTGCCGGC
>probe:Drosophila_2:1641038_at:500:287; Interrogation_Position=1039; Antisense; CGGCGAGTTCCAGTGCATTACATGC
>probe:Drosophila_2:1641038_at:684:17; Interrogation_Position=1064; Antisense; ATTTCGAATGAGGTTTCCGGCTGCT
>probe:Drosophila_2:1641038_at:103:621; Interrogation_Position=1085; Antisense; TGCTGGTCGGCCAAATATCCGGACA
>probe:Drosophila_2:1641038_at:460:651; Interrogation_Position=1122; Antisense; TCAACTGCCCCAATGGAACGTGCTA
>probe:Drosophila_2:1641038_at:376:381; Interrogation_Position=1137; Antisense; GAACGTGCTACAGCGGAGTCTGGAA
>probe:Drosophila_2:1641038_at:617:507; Interrogation_Position=1172; Antisense; GTGCGAGGATGTTTTACCGCTGCCA
>probe:Drosophila_2:1641038_at:4:549; Interrogation_Position=1231; Antisense; GGAGGCCCATCAGTGCGAATTGTGT
>probe:Drosophila_2:1641038_at:235:539; Interrogation_Position=1276; Antisense; GGTACCCTTCAATGGAGCAGGCGCA
>probe:Drosophila_2:1641038_at:200:141; Interrogation_Position=1331; Antisense; ACGGGAGTGGTGATCGCTCTACGCA
>probe:Drosophila_2:1641038_at:337:203; Interrogation_Position=1370; Antisense; AACCACCTCCACGTAGTTGGATGAT
>probe:Drosophila_2:1641038_at:186:447; Interrogation_Position=1392; Antisense; GATCCAATCAAATTACCGGGTGCCT
>probe:Drosophila_2:1641038_at:488:305; Interrogation_Position=1407; Antisense; CCGGGTGCCTGGGTCTATGAGTAAT
>probe:Drosophila_2:1641038_at:364:663; Interrogation_Position=963; Antisense; TAAACACCTTGGAGGCTGGCTGCTC

Paste this into a BLAST search page for me
AAATGGCTGCAATGTGGCTGCCGGCCGGCGAGTTCCAGTGCATTACATGCATTTCGAATGAGGTTTCCGGCTGCTTGCTGGTCGGCCAAATATCCGGACATCAACTGCCCCAATGGAACGTGCTAGAACGTGCTACAGCGGAGTCTGGAAGTGCGAGGATGTTTTACCGCTGCCAGGAGGCCCATCAGTGCGAATTGTGTGGTACCCTTCAATGGAGCAGGCGCAACGGGAGTGGTGATCGCTCTACGCAAACCACCTCCACGTAGTTGGATGATGATCCAATCAAATTACCGGGTGCCTCCGGGTGCCTGGGTCTATGAGTAATTAAACACCTTGGAGGCTGGCTGCTC

Full Affymetrix probeset data:

Annotations for 1641038_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720