FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641039_at:

>probe:Drosophila_2:1641039_at:271:75; Interrogation_Position=484; Antisense; AGGAGCTGGTCCAGTGCACCCCAGA
>probe:Drosophila_2:1641039_at:583:335; Interrogation_Position=546; Antisense; GCTGCTCCAGCGGATGCGAAACTAG
>probe:Drosophila_2:1641039_at:645:147; Interrogation_Position=566; Antisense; ACTAGACTGTTTGCTTTCTGTGCTC
>probe:Drosophila_2:1641039_at:515:715; Interrogation_Position=581; Antisense; TTCTGTGCTCTTAGCCGGCAATGTG
>probe:Drosophila_2:1641039_at:712:29; Interrogation_Position=609; Antisense; ATACATCTTCCAATACTCAGCAACA
>probe:Drosophila_2:1641039_at:529:635; Interrogation_Position=691; Antisense; TCGAATGTTCTTGCTCTGCTTAAGA
>probe:Drosophila_2:1641039_at:669:455; Interrogation_Position=714; Antisense; GATTTTATTGCCGTTTACTCGTGCA
>probe:Drosophila_2:1641039_at:567:145; Interrogation_Position=730; Antisense; ACTCGTGCATTTTTTCGTATCATTT
>probe:Drosophila_2:1641039_at:128:639; Interrogation_Position=744; Antisense; TCGTATCATTTTTCCGATCGCAAAT
>probe:Drosophila_2:1641039_at:121:25; Interrogation_Position=810; Antisense; ATATGGCATAGATCCCGACTTCGGG
>probe:Drosophila_2:1641039_at:358:293; Interrogation_Position=825; Antisense; CGACTTCGGGTCAATCAGCTATCAG
>probe:Drosophila_2:1641039_at:415:561; Interrogation_Position=851; Antisense; GGAACAGACTCGATTGTTTGCGAAA
>probe:Drosophila_2:1641039_at:443:245; Interrogation_Position=907; Antisense; AATTAAATCACTCCTGCTGCGTAAC
>probe:Drosophila_2:1641039_at:41:493; Interrogation_Position=927; Antisense; GTAACACCATTCTCTTTGTTTGCAA

Paste this into a BLAST search page for me
AGGAGCTGGTCCAGTGCACCCCAGAGCTGCTCCAGCGGATGCGAAACTAGACTAGACTGTTTGCTTTCTGTGCTCTTCTGTGCTCTTAGCCGGCAATGTGATACATCTTCCAATACTCAGCAACATCGAATGTTCTTGCTCTGCTTAAGAGATTTTATTGCCGTTTACTCGTGCAACTCGTGCATTTTTTCGTATCATTTTCGTATCATTTTTCCGATCGCAAATATATGGCATAGATCCCGACTTCGGGCGACTTCGGGTCAATCAGCTATCAGGGAACAGACTCGATTGTTTGCGAAAAATTAAATCACTCCTGCTGCGTAACGTAACACCATTCTCTTTGTTTGCAA

Full Affymetrix probeset data:

Annotations for 1641039_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720