FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641041_at:

>probe:Drosophila_2:1641041_at:299:499; Interrogation_Position=1004; Antisense; GTCGGCGTCTACTGCGAAACTTTTT
>probe:Drosophila_2:1641041_at:654:225; Interrogation_Position=620; Antisense; AAGGCAGCGGGCTTTTCCAAGGTCG
>probe:Drosophila_2:1641041_at:455:603; Interrogation_Position=634; Antisense; TTCCAAGGTCGATCCAAGTCACTAC
>probe:Drosophila_2:1641041_at:297:555; Interrogation_Position=672; Antisense; GGACCATGGGTCTGCTGGCCTTCGA
>probe:Drosophila_2:1641041_at:330:635; Interrogation_Position=693; Antisense; TCGATCGGCCGGAATACAGTCCCTA
>probe:Drosophila_2:1641041_at:122:335; Interrogation_Position=724; Antisense; GCTGATGTACTACTCATATCGCCAA
>probe:Drosophila_2:1641041_at:545:59; Interrogation_Position=776; Antisense; ATGTTACGCTGCCACGAGGATGAGA
>probe:Drosophila_2:1641041_at:274:443; Interrogation_Position=835; Antisense; GATGTTCCTCATCAAGCTAATCCTT
>probe:Drosophila_2:1641041_at:184:33; Interrogation_Position=845; Antisense; ATCAAGCTAATCCTTTGGGCCCAGG
>probe:Drosophila_2:1641041_at:698:543; Interrogation_Position=877; Antisense; GGATCGCGAGGGATTCACCGACTAC
>probe:Drosophila_2:1641041_at:333:671; Interrogation_Position=899; Antisense; TACCACAAGCTTGATCTTGGCCACG
>probe:Drosophila_2:1641041_at:317:275; Interrogation_Position=914; Antisense; CTTGGCCACGCGGATTTCGAGGAAG
>probe:Drosophila_2:1641041_at:691:629; Interrogation_Position=954; Antisense; TCCAGGGTTTCTAAGTCCATAAGCA
>probe:Drosophila_2:1641041_at:328:237; Interrogation_Position=985; Antisense; AATTGTCCAACGATTGTCGGTCGGC

Paste this into a BLAST search page for me
GTCGGCGTCTACTGCGAAACTTTTTAAGGCAGCGGGCTTTTCCAAGGTCGTTCCAAGGTCGATCCAAGTCACTACGGACCATGGGTCTGCTGGCCTTCGATCGATCGGCCGGAATACAGTCCCTAGCTGATGTACTACTCATATCGCCAAATGTTACGCTGCCACGAGGATGAGAGATGTTCCTCATCAAGCTAATCCTTATCAAGCTAATCCTTTGGGCCCAGGGGATCGCGAGGGATTCACCGACTACTACCACAAGCTTGATCTTGGCCACGCTTGGCCACGCGGATTTCGAGGAAGTCCAGGGTTTCTAAGTCCATAAGCAAATTGTCCAACGATTGTCGGTCGGC

Full Affymetrix probeset data:

Annotations for 1641041_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720