FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641042_at:

>probe:Drosophila_2:1641042_at:557:639; Interrogation_Position=1012; Antisense; TCGGAGGACTGCGTCTGGTGCCCAA
>probe:Drosophila_2:1641042_at:391:269; Interrogation_Position=1055; Antisense; CATCGACAACATCAAGGCCACCATT
>probe:Drosophila_2:1641042_at:348:591; Interrogation_Position=1112; Antisense; TGGTCAGCAGCGTCTCAGTTTACAT
>probe:Drosophila_2:1641042_at:555:91; Interrogation_Position=1128; Antisense; AGTTTACATCGCCTGAATGCCAATG
>probe:Drosophila_2:1641042_at:155:533; Interrogation_Position=1175; Antisense; GGTGGCCAATGGCATCTTCTCCGAT
>probe:Drosophila_2:1641042_at:222:37; Interrogation_Position=1188; Antisense; ATCTTCTCCGATCGCAACCTGAATG
>probe:Drosophila_2:1641042_at:527:367; Interrogation_Position=1208; Antisense; GAATGCCATGATTCTCAATCTGGTC
>probe:Drosophila_2:1641042_at:184:41; Interrogation_Position=1225; Antisense; ATCTGGTCAACGAGAATCTGCCGGA
>probe:Drosophila_2:1641042_at:571:425; Interrogation_Position=1248; Antisense; GAGATCACACGCGTCGGAATTCCCG
>probe:Drosophila_2:1641042_at:533:709; Interrogation_Position=1297; Antisense; TTCTAATTGCCCACATCAACGAGTT
>probe:Drosophila_2:1641042_at:482:717; Interrogation_Position=1323; Antisense; TTCGCCAAGGTACCCATCGAGAAAT
>probe:Drosophila_2:1641042_at:201:473; Interrogation_Position=1353; Antisense; GTTCAATAATGCACCAAGCGCGTCC
>probe:Drosophila_2:1641042_at:660:501; Interrogation_Position=1374; Antisense; GTCCTCAAGGATCACTTAGCTCCTA
>probe:Drosophila_2:1641042_at:37:241; Interrogation_Position=1429; Antisense; AATTTATCTTAAGCGCTGTTTCCAA

Paste this into a BLAST search page for me
TCGGAGGACTGCGTCTGGTGCCCAACATCGACAACATCAAGGCCACCATTTGGTCAGCAGCGTCTCAGTTTACATAGTTTACATCGCCTGAATGCCAATGGGTGGCCAATGGCATCTTCTCCGATATCTTCTCCGATCGCAACCTGAATGGAATGCCATGATTCTCAATCTGGTCATCTGGTCAACGAGAATCTGCCGGAGAGATCACACGCGTCGGAATTCCCGTTCTAATTGCCCACATCAACGAGTTTTCGCCAAGGTACCCATCGAGAAATGTTCAATAATGCACCAAGCGCGTCCGTCCTCAAGGATCACTTAGCTCCTAAATTTATCTTAAGCGCTGTTTCCAA

Full Affymetrix probeset data:

Annotations for 1641042_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720