FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641043_at:

>probe:Drosophila_2:1641043_at:713:355; Interrogation_Position=1005; Antisense; GCAAATCAACAACAGCTTCGAACCC
>probe:Drosophila_2:1641043_at:280:629; Interrogation_Position=1102; Antisense; TCCAGCGAATCCAAGCCCAATGTGT
>probe:Drosophila_2:1641043_at:81:307; Interrogation_Position=1178; Antisense; CCAGTGCGGGCATCAGGGAGTTCTA
>probe:Drosophila_2:1641043_at:33:105; Interrogation_Position=644; Antisense; AGACGCCCAACATTTCCGAGATGTT
>probe:Drosophila_2:1641043_at:363:651; Interrogation_Position=669; Antisense; TCACAAATCATTTGGAGCTCCGCCA
>probe:Drosophila_2:1641043_at:573:175; Interrogation_Position=749; Antisense; AAACGCCGCCATGTACGGGAGCAGG
>probe:Drosophila_2:1641043_at:265:75; Interrogation_Position=771; Antisense; AGGAGCCGGATCTACTGGCGGTCCT
>probe:Drosophila_2:1641043_at:373:409; Interrogation_Position=823; Antisense; GACGAACTACTCAACATAGCCTGCG
>probe:Drosophila_2:1641043_at:544:481; Interrogation_Position=849; Antisense; GTATTTGGCTGGCACATATCCGGAG
>probe:Drosophila_2:1641043_at:658:23; Interrogation_Position=864; Antisense; ATATCCGGAGGAGGAGTCCATCGCC
>probe:Drosophila_2:1641043_at:586:497; Interrogation_Position=932; Antisense; GTCTTCTGGCCGAACGTTTCATCAA
>probe:Drosophila_2:1641043_at:428:199; Interrogation_Position=955; Antisense; AACGAGATTCTCTTCGAGGCCGAGT
>probe:Drosophila_2:1641043_at:565:439; Interrogation_Position=970; Antisense; GAGGCCGAGTCCAACAATCTGCATC
>probe:Drosophila_2:1641043_at:4:41; Interrogation_Position=986; Antisense; ATCTGCATCGCGGATCTGTGCAAAT

Paste this into a BLAST search page for me
GCAAATCAACAACAGCTTCGAACCCTCCAGCGAATCCAAGCCCAATGTGTCCAGTGCGGGCATCAGGGAGTTCTAAGACGCCCAACATTTCCGAGATGTTTCACAAATCATTTGGAGCTCCGCCAAAACGCCGCCATGTACGGGAGCAGGAGGAGCCGGATCTACTGGCGGTCCTGACGAACTACTCAACATAGCCTGCGGTATTTGGCTGGCACATATCCGGAGATATCCGGAGGAGGAGTCCATCGCCGTCTTCTGGCCGAACGTTTCATCAAAACGAGATTCTCTTCGAGGCCGAGTGAGGCCGAGTCCAACAATCTGCATCATCTGCATCGCGGATCTGTGCAAAT

Full Affymetrix probeset data:

Annotations for 1641043_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720