FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641045_at:

>probe:Drosophila_2:1641045_at:95:75; Interrogation_Position=1006; Antisense; AGGACTTGGCCTACGCGGGTCAGAA
>probe:Drosophila_2:1641045_at:60:659; Interrogation_Position=1108; Antisense; TAAGTAGCTGAAACACACCGCTCTC
>probe:Drosophila_2:1641045_at:280:299; Interrogation_Position=1126; Antisense; CGCTCTCGGCGTATTGTTTATTTAT
>probe:Drosophila_2:1641045_at:401:337; Interrogation_Position=1236; Antisense; GCTCTGGTGTCCCTTTGTGTAAATA
>probe:Drosophila_2:1641045_at:555:285; Interrogation_Position=696; Antisense; CTGTCTGGAGCCTTGGTTATTTTCA
>probe:Drosophila_2:1641045_at:116:465; Interrogation_Position=722; Antisense; GATTGCCAAGCCCAAGATTGTCAAC
>probe:Drosophila_2:1641045_at:687:599; Interrogation_Position=740; Antisense; TGTCAACTACGAGGTGGTGCACTAT
>probe:Drosophila_2:1641045_at:491:147; Interrogation_Position=760; Antisense; ACTATCCCCATCACGTGGATCATGT
>probe:Drosophila_2:1641045_at:189:141; Interrogation_Position=772; Antisense; ACGTGGATCATGTGGTGCCGCATCA
>probe:Drosophila_2:1641045_at:712:625; Interrogation_Position=787; Antisense; TGCCGCATCACATTGAGCACGTGGT
>probe:Drosophila_2:1641045_at:491:637; Interrogation_Position=847; Antisense; TCGAGCACATAGTGCCGCATCACAT
>probe:Drosophila_2:1641045_at:708:297; Interrogation_Position=862; Antisense; CGCATCACATCGATCATCATCTGGA
>probe:Drosophila_2:1641045_at:240:41; Interrogation_Position=880; Antisense; ATCTGGAGCACCACATCGATCACCA
>probe:Drosophila_2:1641045_at:664:359; Interrogation_Position=986; Antisense; GCAAGAGCCGCAGGATGCCCAGGAC

Paste this into a BLAST search page for me
AGGACTTGGCCTACGCGGGTCAGAATAAGTAGCTGAAACACACCGCTCTCCGCTCTCGGCGTATTGTTTATTTATGCTCTGGTGTCCCTTTGTGTAAATACTGTCTGGAGCCTTGGTTATTTTCAGATTGCCAAGCCCAAGATTGTCAACTGTCAACTACGAGGTGGTGCACTATACTATCCCCATCACGTGGATCATGTACGTGGATCATGTGGTGCCGCATCATGCCGCATCACATTGAGCACGTGGTTCGAGCACATAGTGCCGCATCACATCGCATCACATCGATCATCATCTGGAATCTGGAGCACCACATCGATCACCAGCAAGAGCCGCAGGATGCCCAGGAC

Full Affymetrix probeset data:

Annotations for 1641045_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720